View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5970_high_45 (Length: 258)
Name: NF5970_high_45
Description: NF5970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5970_high_45 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 226
Target Start/End: Original strand, 45549520 - 45549728
Alignment:
| Q |
18 |
catatgacataaattggcggttttagatcctactcagtcagtgcttaccaaatcattggccgattcttgtaaatcttcactcttgccagcattgtacaac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45549520 |
catatgacataaattggcggttttagatcctactcagtcagtgcttaccaaatcattggccgattcttgtaaatcttcactcttgccagaattgtacaac |
45549619 |
T |
 |
| Q |
118 |
gtagaagtaggaagcagttcatgttctgtgaatatgctaaaccttttttggtctgctccatttaagacattcaattttccagatgctctaccactagctt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45549620 |
gtagaagtaggaagcagttcatgttctgtgaatatgctaaaccttttttggtctgctccatttaagacattcaattttccagatgctctaccactagctt |
45549719 |
T |
 |
| Q |
218 |
cttgttcat |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
45549720 |
cttgttcat |
45549728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University