View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5970_high_46 (Length: 253)

Name: NF5970_high_46
Description: NF5970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5970_high_46
NF5970_high_46
[»] chr6 (1 HSPs)
chr6 (1-236)||(2382124-2382348)


Alignment Details
Target: chr6 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 2382124 - 2382348
Alignment:
1 gatgaaattctctcggcaggtggagttgtggcagaacatcatgcatcctgttcgtaggttttggatttccattgccacacgttttggaattcgtaaaact 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2382124 gatgaaattctctcggcaggtggagttgtggcagaacatcatgcatcctgttcgtaggttttggatttccattgccacacgttttggaattcgtaaaact 2382223  T
101 ggtaataattcaaaacatgtttggtcctttttctgtatttttggttacatagtacatgtttggttttgatgtttgcaaattcttcaaacaatagcatgtg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||           |||||||||||    
2382224 ggtaataattcaaaacatgtttggtcctttttctgtatttttggttacatagtacatgtttggttttgatgtttgcaa-----------aatagcatgtg 2382312  T
201 ctgagttttgcacgttaattgtaacatattttgatc 236  Q
    ||||||||||||||||||||||||||||||||||||    
2382313 ctgagttttgcacgttaattgtaacatattttgatc 2382348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University