View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5970_high_54 (Length: 248)
Name: NF5970_high_54
Description: NF5970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5970_high_54 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 81; Significance: 3e-38; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 18 - 111
Target Start/End: Original strand, 2013012 - 2013107
Alignment:
| Q |
18 |
cttttctagttcctaatct--tattggaagttagtttctaaaatttgtgcacttgagctacaattgccttatgagtcaggttcaatattggtagag |
111 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2013012 |
cttttctagttcctaatctagtattggaagttagtttctaaaatttgtgcacttgagctacaattgccttttgagtcaggttcaatattggtagag |
2013107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 89 - 238
Target Start/End: Original strand, 2007608 - 2007754
Alignment:
| Q |
89 |
agtcaggttcaatattggtagagttagttacaaatttagtgcagt-tagtcctataaatc--agactcatgtatcttctttttcatgctgtctcaatcaa |
185 |
Q |
| |
|
||||||||||||| | |||||||||||||||| |||||||||||| | |||||||||| |||||||||||||||||||||||| || | |||||||| |
|
|
| T |
2007608 |
agtcaggttcaatttaggtagagttagttacagatttagtgcagtagaaccctataaatcagagactcatgtatcttctttttcat-ctttatcaatcaa |
2007706 |
T |
|
| Q |
186 |
tacaatatgattttccgagtataaatataaatatactttttatttttcctatg |
238 |
Q |
| |
|
||||||||||||| | ||||||| ||||||||||||||||||||||||| |
|
|
| T |
2007707 |
tacaatatgatttacagagtata-----aaatatactttttatttttcctatg |
2007754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 140 - 198
Target Start/End: Original strand, 2020858 - 2020916
Alignment:
| Q |
140 |
tataaatcagactcatgtatcttctttttcatgctgtctcaatcaatacaatatgattt |
198 |
Q |
| |
|
|||||||||||||||||||||||| | |||||| ||| ||||||||||||||||||||| |
|
|
| T |
2020858 |
tataaatcagactcatgtatcttcctattcatgttgtatcaatcaatacaatatgattt |
2020916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 37 - 84
Target Start/End: Original strand, 2020749 - 2020796
Alignment:
| Q |
37 |
tattggaagttagtttctaaaatttgtgcacttgagctacaattgcct |
84 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||| ||| ||||||| |
|
|
| T |
2020749 |
tattggaagttagtttctaaaacttgtacacttgagttacgattgcct |
2020796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University