View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5970_high_58 (Length: 244)
Name: NF5970_high_58
Description: NF5970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5970_high_58 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 10 - 229
Target Start/End: Original strand, 30089830 - 30090049
Alignment:
| Q |
10 |
gtcgaagaatatacttcttgacgcaaatcttgaggcaaggatagcagatttcggattagccaagatgatggttcggaagaatgaaacagtctccatgatt |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30089830 |
gtcgaataatatacttcttgacgcaaatcttgaggcaaggatagcagatttcggattagccaagatgatggttcggaagaatgaaacagtctccatgatt |
30089929 |
T |
 |
| Q |
110 |
gccggatcctatggatacattgcccctggtgagttactccttacaatactgactatttttatttttgcagggtaagcaatgtttcttcattgtccgattt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30089930 |
gccggatcctatggatacattgcccctggtgagttactccttacaatactgactatttttatttttgcagggtaagcaatgtttcttcattgttcgattt |
30090029 |
T |
 |
| Q |
210 |
aaaatattcacatatctaac |
229 |
Q |
| |
|
||||||||||||| |||||| |
|
|
| T |
30090030 |
aaaatattcacatttctaac |
30090049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 20 - 93
Target Start/End: Complemental strand, 35781381 - 35781308
Alignment:
| Q |
20 |
atacttcttgacgcaaatcttgaggcaaggatagcagatttcggattagccaagatgatggttcggaagaatga |
93 |
Q |
| |
|
||||| |||||||||||| | ||||||||||||||||||||||| || || | ||||||| ||| |||||||| |
|
|
| T |
35781381 |
atactccttgacgcaaatttggaggcaaggatagcagatttcggtttggcgaggatgatgattcaaaagaatga |
35781308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 17 - 147
Target Start/End: Complemental strand, 39468111 - 39467981
Alignment:
| Q |
17 |
aatatacttcttgacgcaaatcttgaggcaaggatagcagatttcggattagccaagatgatggttcggaagaatgaaacagtctccatgattgccggat |
116 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||||||| ||||||||||||||| | | |||||| |||||||| |||||| ||||||||| |
|
|
| T |
39468111 |
aatatactgcttgatgcaaatcttgaggcaaggatagcagatttcgggttagccaagatgatgatccagaagaacgaaacagtatccatggttgccggat |
39468012 |
T |
 |
| Q |
117 |
cctatggatacattgcccctggtgagttact |
147 |
Q |
| |
|
||||||| ||||| || |||||| ||||||| |
|
|
| T |
39468011 |
cctatggctacatcgctcctggtaagttact |
39467981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University