View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5970_high_62 (Length: 214)
Name: NF5970_high_62
Description: NF5970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5970_high_62 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 19 - 198
Target Start/End: Complemental strand, 401958 - 401779
Alignment:
| Q |
19 |
acctgtaagtaataatttcacctttttgtctattttttatagaaaattcttnnnnnnntaacaatcttcctacacttcaattatttatagtttgatgagt |
118 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401958 |
acctgtgagtaataatttcacctttttgtctattttttatagaaaattcttaaaaaaataacaatcttcctacacttcaattatttatagtttgatgagt |
401859 |
T |
 |
| Q |
119 |
gaatcactctatataaattataacaattatttttgtgaatgatattcttatgcttgacgtagcattaaatttgtttctgt |
198 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401858 |
gagtcactctatataaattataacaattatttttgtgaatgatattcttatgcttgacgtagcattaaatttgtttctgt |
401779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University