View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5970_low_11 (Length: 449)
Name: NF5970_low_11
Description: NF5970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5970_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 272; Significance: 1e-152; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 158 - 441
Target Start/End: Original strand, 41277565 - 41277848
Alignment:
| Q |
158 |
gttgcagaattagggtttagcggtgttaccaaatgtgatgatcaccctcattggtccaagcatccatacaaataggacaaatgagtccatcaatatcggt |
257 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277565 |
gttgcagaattagggtttagcagtgttaccaaatgtgatgatcgccctcattggtccaagcatccatacaaataggacaaatgagtccatcaatatcggt |
41277664 |
T |
 |
| Q |
258 |
acggttgcattcattctcttggctacaatcaacactttcaatcggaatcgacaacgaagaagcctctcctccttcaattctgcggcgtttgtttatctcg |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41277665 |
acggttgcattcattctcttggctacaatcaacactttcaatcggaatcgacaacgaagaagcctctcctccttcaattctgcggcgtttgtttctctcg |
41277764 |
T |
 |
| Q |
358 |
tcgccgggaataacacttacttcgtcggatcgggaaaccctagacgacggcacatcgggaacatattcttcatcgtcttcatct |
441 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277765 |
tcgccgggaataacacttacttcgtcggatcgggaaaccctagacgacggcacatcgggaacatattcttcatcgtcttcatct |
41277848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 18 - 86
Target Start/End: Original strand, 41277424 - 41277493
Alignment:
| Q |
18 |
aagacaactaaaatcattcatcccaaaa-aacatagtaaatcaactacaatttaacagtgtgagaatatc |
86 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41277424 |
aagacaactaaaatcattcatcccaaaaaaacatagtaaatcaaccacaatttaacagtgtgagaatatc |
41277493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University