View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5970_low_15 (Length: 411)
Name: NF5970_low_15
Description: NF5970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5970_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 3e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 3e-95
Query Start/End: Original strand, 11 - 219
Target Start/End: Complemental strand, 28203579 - 28203373
Alignment:
| Q |
11 |
catagggtattttttaaaagtagtgtgtaatcttaaactaggcatataataagacagataaaataagtaatattctttgttgtcaataatatgttaaatt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | |||||||||||||||||||| || |
|
|
| T |
28203579 |
catagggtattttttaaaagtagtgtgtaatcttaaactaggcttataataagacagataaaataagtaatattttgtgttgtcaataatatgttaa-tt |
28203481 |
T |
|
| Q |
111 |
tgtccaacacatatagttgcgtgtcactcaaccataacttagagtttctgtgaatcacacgtgtcttggctttgcttctccctaatcaatagatgcaaac |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
28203480 |
tgtccaacacatatagttgcgtgtcactcaaccataacttagagtttctgtgaatcacacgtgtcttggctttgcttctcccttatcaat-gatgcaaac |
28203382 |
T |
|
| Q |
211 |
acaacaaat |
219 |
Q |
| |
|
||||||||| |
|
|
| T |
28203381 |
acaacaaat |
28203373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University