View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5970_low_27 (Length: 311)
Name: NF5970_low_27
Description: NF5970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5970_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 11 - 297
Target Start/End: Complemental strand, 11212912 - 11212623
Alignment:
| Q |
11 |
caaaggtttgccataaaacgacaccgtttttagtctccagaactaaatttccattttctagaagattgagttgaggaagaggagattca---agagtgtt |
107 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
11212912 |
caaagctttgccataaaacgacaccgtttttagtctcgagaactaaatttccattttctagaagattcagttgaggaagaggagattcatcaagagtgtt |
11212813 |
T |
|
| Q |
108 |
tttagtttgccataaaacggtgtcgttttgggttaagagtaattgaccggttcgagttaattgaagtgctgaaccggtgagagatgagatgggtttattc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11212812 |
tttagtttgccataaaacggtgtcgttttgggttaagagtaattgaccggttggggttaattgaagagctgaaccggtgagagatgagatgggtttatta |
11212713 |
T |
|
| Q |
208 |
cggtttgcgacccaaatgatgtttggagaagggagggaagtgaaacggatggaaagatagtaacgaggttgtagttggttttgttgttct |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11212712 |
cggtttgcgacccaaatgatgtttggagaagggagggaagtgaaacggatggaaagatagtaacgaggttgtagttggttttgttgttct |
11212623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University