View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5970_low_57 (Length: 247)
Name: NF5970_low_57
Description: NF5970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5970_low_57 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 11612959 - 11613196
Alignment:
| Q |
1 |
tagatgtagatgtcaaacattcatatgtataattgagtagagcataaccaagtggttgatgagtttaagttacggtcggatcaatgaggagtacttgagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11612959 |
tagatgtagatgtcaaacattcatatgtataattgagtagagcataaccaagtggttgatgagtttaagttacggtcggattaatgaggagtacttgagt |
11613058 |
T |
|
| Q |
101 |
tcgatccctgacttaaacaatctttggctagactttgcttaccttctggccgaactttggattaccagaacccc----------ttttttctttctgaga |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11613059 |
tcgatccctgacttaaacaatctttggctagactttgcttaccttctggccgaactttggattaccagaaccccttttttttttttttttctttctgaga |
11613158 |
T |
|
| Q |
191 |
accatatggttaaaacaaaacaaaaatcagtagagtac |
228 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
11613159 |
actatatggttaaaacaaaacaaaaatcagtagagtac |
11613196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 174
Target Start/End: Complemental strand, 39085196 - 39085132
Alignment:
| Q |
110 |
gacttaaacaatctttggctagactttgcttaccttctggccgaactttggattaccagaacccc |
174 |
Q |
| |
|
||||| ||||||| ||||| |||||| ||||||| || |||||||||||||||||||| |||| |
|
|
| T |
39085196 |
gacttgaacaatcattggcaagacttcacttacctcctaaccgaactttggattaccagaccccc |
39085132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University