View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5970_low_57 (Length: 247)

Name: NF5970_low_57
Description: NF5970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5970_low_57
NF5970_low_57
[»] chr8 (2 HSPs)
chr8 (1-228)||(11612959-11613196)
chr8 (110-174)||(39085132-39085196)


Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 11612959 - 11613196
Alignment:
1 tagatgtagatgtcaaacattcatatgtataattgagtagagcataaccaagtggttgatgagtttaagttacggtcggatcaatgaggagtacttgagt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
11612959 tagatgtagatgtcaaacattcatatgtataattgagtagagcataaccaagtggttgatgagtttaagttacggtcggattaatgaggagtacttgagt 11613058  T
101 tcgatccctgacttaaacaatctttggctagactttgcttaccttctggccgaactttggattaccagaacccc----------ttttttctttctgaga 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||||||||    
11613059 tcgatccctgacttaaacaatctttggctagactttgcttaccttctggccgaactttggattaccagaaccccttttttttttttttttctttctgaga 11613158  T
191 accatatggttaaaacaaaacaaaaatcagtagagtac 228  Q
    || |||||||||||||||||||||||||||||||||||    
11613159 actatatggttaaaacaaaacaaaaatcagtagagtac 11613196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 174
Target Start/End: Complemental strand, 39085196 - 39085132
Alignment:
110 gacttaaacaatctttggctagactttgcttaccttctggccgaactttggattaccagaacccc 174  Q
    ||||| ||||||| ||||| ||||||  ||||||| ||  |||||||||||||||||||| ||||    
39085196 gacttgaacaatcattggcaagacttcacttacctcctaaccgaactttggattaccagaccccc 39085132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University