View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5970_low_58 (Length: 247)
Name: NF5970_low_58
Description: NF5970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5970_low_58 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 31009585 - 31009816
Alignment:
| Q |
1 |
agtcataatacaaactcatcatctttattgggtttttcaccaaaggnnnnnnnnatttgggcttgtttcccttttcaattgggtttgaatgcaattccaa |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31009585 |
agtcacaatacaaactcatcatctttattgggtttttcaccaaaggttttttttatttgggcttgtttcccttttcaattgggtttgaatgcaattccaa |
31009684 |
T |
|
| Q |
101 |
gtttgacacatttggctcctttgagtatatttgctgatgttgttgatcttggagctatgggagttgtaatggttgaggatgtttttgtctttttggaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31009685 |
gtttgacacatttggctcctttgagtatatttgctgatgttgttgatcttggagctatgggagttgtaatggttgaggatgtttttgtctttttggaaaa |
31009784 |
T |
|
| Q |
201 |
taggccacctttgaagacttttggtggtttat |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
31009785 |
taggccacctttgaagacttttggtggtttat |
31009816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 56 - 188
Target Start/End: Complemental strand, 9783041 - 9782909
Alignment:
| Q |
56 |
tttgggcttgtttcccttttcaattgggtttgaatgcaattccaagtttgacacatttggctcctttgagtatatttgctgatgttgttgatcttggagc |
155 |
Q |
| |
|
|||||| |||||| || |||||||| || |||||| | || || |||||| ||||| || ||||||||||| |||||||||||||||||| || || |
|
|
| T |
9783041 |
tttggggttgttttccatttcaattagggttgaattcgatcaaaactttgacccatttagcccctttgagtatttttgctgatgttgttgatatttctgc |
9782942 |
T |
|
| Q |
156 |
tatgggagttgtaatggttgaggatgtttttgt |
188 |
Q |
| |
|
|| | | ||||| |||||||| ||||||||||| |
|
|
| T |
9782941 |
taagagtgttgttatggttgaagatgtttttgt |
9782909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University