View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5970_low_61 (Length: 230)
Name: NF5970_low_61
Description: NF5970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5970_low_61 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 7093406 - 7093176
Alignment:
| Q |
1 |
taatactaaaccatttcttttggtgaagagaaacaatctcttgaaagt-gaaagagtttgtttatgaataaacacaatgattacattgtttcgatgaacc |
99 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7093406 |
taatactcaaccatttcctttggtgaagagaaacaatctcttgaaagttgaaagagtttgtttatgaataaacacaatgattacattgtttcgatgaacc |
7093307 |
T |
|
| Q |
100 |
annnnnnnnnnnnatagtgcacaagagtaatcgaagaaattttattctataagctattattgatcgataaggttgatatgagtgtgcaagccacgtccaa |
199 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7093306 |
atttttcttttttatagtgcacaagagtaatcgaagaaattttattctataagctattattgatcgataagattgatatgagtgtgcaagccacgtccaa |
7093207 |
T |
|
| Q |
200 |
aattttaaactatcataaaggagtttcacca |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7093206 |
aattttaaactatcataaaggagtttcacca |
7093176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University