View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5970_low_64 (Length: 211)
Name: NF5970_low_64
Description: NF5970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5970_low_64 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 45935136 - 45935346
Alignment:
| Q |
1 |
atgggcatcagatgcttttcatgggtaaacgaagatttggcaccaactttcagctcaagttccgtattctcaaggcacttctgtttcttggcttcttgtc |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45935136 |
atgggcatcagatgctttccatgggtaaacgaagatttggcaccaactttcagctcaagttccgtattctcaaggcacttctatttcttggcttcttgtc |
45935235 |
T |
 |
| Q |
101 |
agtaatgatagtgttatttgttgtgtgtgcgcttacggtatcagatttgtttgcttccgttcttgccttcatgccctctggatgggccattattctggta |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45935236 |
agtaatgatagtgttatttgttgtgtgcgcgcttacggtatcagatttgtttgcttccgttcttgccttcatgccctctggatgggccattattctggta |
45935335 |
T |
 |
| Q |
201 |
agctaaaattc |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
45935336 |
agctaaaattc |
45935346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 15817365 - 15817571
Alignment:
| Q |
1 |
atgggcatcagatgcttttcatgggtaaacgaagatttggcaccaactttcagctcaagttccgtattctcaaggcacttctgtttcttggcttcttgtc |
100 |
Q |
| |
|
||||| |||||||| ||| |||||||| |||||||||||| ||| |||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
15817365 |
atgggtatcagatggtttccatgggtagacgaagatttggtaccgactttcagctcatgttccgtattctcaaggcacttctgtttctcggcttcttgtc |
15817464 |
T |
 |
| Q |
101 |
agtaatgatagtgttatttgttgtgtgtgcgcttacggtatcagatttgtttgcttccgttcttgccttcatgccctctggatgggccattattctggta |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15817465 |
agtaatggcagtgttatttgttgtgtgtgcgcttacggtatcagatttgtttgcttccgttcttgccttcatgccctctggatgggccattattctggta |
15817564 |
T |
 |
| Q |
201 |
agctaaa |
207 |
Q |
| |
|
||||||| |
|
|
| T |
15817565 |
agctaaa |
15817571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University