View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5971-Insertion-12 (Length: 281)
Name: NF5971-Insertion-12
Description: NF5971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5971-Insertion-12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 9 - 201
Target Start/End: Complemental strand, 7753210 - 7753018
Alignment:
| Q |
9 |
cttctcactctttttcctaaggttgcactatttaattgtcagaaaattggaaaaaaccactacttttggctgagatcctgcaggtagggattggattact |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7753210 |
cttctcactctttttcctaaggttgcactatttaattgtcagaaaattggaaaaaaccactacttttggctgagatcctgcaggtagggattggattact |
7753111 |
T |
|
| Q |
109 |
tgtacttcagcaattgagtggaaccaatggagttttgttttattcaagtacaatctttctaaatgcaggttaggtcttcctatcagttcacaa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7753110 |
tgtacttcagcaattgagtggaaccaatggagttttgttttattcaagtacaatctttctaaatgcaggttaggtcttcctatcagttgacaa |
7753018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 238 - 281
Target Start/End: Complemental strand, 7753020 - 7752977
Alignment:
| Q |
238 |
caacatatactttctttttcctaatcttttttcattttatattg |
281 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
7753020 |
caacatatactttctttttcctaatattttctcattttatattg |
7752977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 85 - 180
Target Start/End: Original strand, 32929905 - 32930000
Alignment:
| Q |
85 |
cctgcaggtagggattggattacttgtacttcagcaattgagtggaaccaatggagttttgttttattcaagtacaatctttctaaatgcaggtta |
180 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| | ||||||||||||||| ||||||| || |||||| |||||||||||| |
|
|
| T |
32929905 |
cctgcaggtaggaattggattacttgtacttcagcaattgagtggtatcaatggagttttgttctattcaactagcatctttgcaaatgcaggtta |
32930000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University