View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5971-Insertion-9 (Length: 446)
Name: NF5971-Insertion-9
Description: NF5971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5971-Insertion-9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 9 - 220
Target Start/End: Complemental strand, 29072240 - 29072029
Alignment:
| Q |
9 |
aatacattacattgcttccataaaattaaatggacaagaaaattcttgatctcatattagtccctagtggcctctttgtaatggttgcataccatttatg |
108 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29072240 |
aatacattacattgcttctataaaattaaatggacaagaaaattcttgatctcatattagtccctagtggcctctttgtaatggttgcataccatttatg |
29072141 |
T |
 |
| Q |
109 |
gcttctctaccaagttgttaaacaccccacaaaaactgtcattggtgtcaattcaatcaatcgtcgttattgggttcaagctatgatggaggtacatgca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29072140 |
gcttctctaccaagttgttaaacaccccacaaaaactgtcattggtgtcaattcaatcaatcgtcgttattgggttcaagctatgatggaggtacatgca |
29072041 |
T |
 |
| Q |
209 |
taacatatttct |
220 |
Q |
| |
|
|||||||||||| |
|
|
| T |
29072040 |
taacatatttct |
29072029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University