View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5971_high_15 (Length: 232)
Name: NF5971_high_15
Description: NF5971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5971_high_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 14 - 207
Target Start/End: Original strand, 16634659 - 16634852
Alignment:
| Q |
14 |
agaatatataggtcaacttggtgcactaaaatttccgcatacgcgatatgttttttgccactatatgatgttttcaaaacttgaacttaatatgtgacct |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||| ||||||||||| ||||||||| |||||||||||||||||| ||| ||||||| |
|
|
| T |
16634659 |
agaacatataggtcaacttggtgcactaaaatttccgcattcgcaatatgtttttttacactatatgttgttttcaaaacttgaacctaaaccgtgacct |
16634758 |
T |
|
| Q |
114 |
ttcaatcgcataaaaacaatttcacgttgcgtcgagacttactttcttgtaaaaaagaaaacattactggtagataaatattattccactcgat |
207 |
Q |
| |
|
||||||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16634759 |
ttcaatcacataacaacaatttcactttgcgtcgagacttactttcttgtaaaaaagaaaacattactggtagataaatattattccactcgat |
16634852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University