View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5971_low_19 (Length: 217)
Name: NF5971_low_19
Description: NF5971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5971_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 1 - 176
Target Start/End: Complemental strand, 24227459 - 24227283
Alignment:
| Q |
1 |
cttttgtttttagtactcagcaatggtggtcgtgcccttttgtctgttcgggcatcgactaatgctgatgttgtatgtttgtgaattggatactctttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24227459 |
cttttgtttttagtactcagcaatggtggtcgtgcccttttgtctgtttgggcatcgactaatgctgatgttgtatgtttgtgaattggatactctttgt |
24227360 |
T |
 |
| Q |
101 |
tccttttaatagtctcaaagacacatcttatactttcggaattgctctattgt-gttataaaatctcattttgactt |
176 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||| ||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
24227359 |
tccttttaatagtctcaaaggcgcatcttatactttcgaaattgctttattgtagttataaaatctcattttgactt |
24227283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 587160 - 587054
Alignment:
| Q |
1 |
cttttgtttttagtactcagcaatggtggtcgtgcccttttgtctgttcgggcatcgactaatgctgatgttgtatgtttgtgaattggatactctttgt |
100 |
Q |
| |
|
||||||||||| |||| || ||||||| ||||||||||||||| |||| || ||||| ||||||| | ||||| || ||||| | |||| | ||||||| |
|
|
| T |
587160 |
cttttgtttttggtacacaacaatggtagtcgtgcccttttgtttgtttggacatcggctaatgcgggtgttgaatatttgtaacttgggtcctctttga |
587061 |
T |
 |
| Q |
101 |
tcctttt |
107 |
Q |
| |
|
||||||| |
|
|
| T |
587060 |
tcctttt |
587054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University