View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5971_low_8 (Length: 343)
Name: NF5971_low_8
Description: NF5971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5971_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 1e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 16 - 177
Target Start/End: Complemental strand, 1253168 - 1253007
Alignment:
| Q |
16 |
acatgaagcattagagtccaataatttgaaaataacatataaacaagtatgtaaatatgcaacattttggaatttctatgcgnnnnnnnctatgtaacca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1253168 |
acatgaagcattagagtccaataatttgaaaataacatataaacaagtatgtaaatattcaacattttggaatttctatgcgaaaaaaactatgtaacca |
1253069 |
T |
|
| Q |
116 |
atcgtttgaaaatttcttctatatcacaaaagactgcattttagcacctctgtgggtgtgag |
177 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1253068 |
atcgtttgaaaatttcttgtatatcacaaaagactgcattttagcacctctgtaggtgtgag |
1253007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 232 - 332
Target Start/End: Complemental strand, 1252953 - 1252853
Alignment:
| Q |
232 |
ccattgtattccttgttttgaaagaattatttgatgttaactctgttagtcataagttaacagttggaaaaccttagtttgtctcaaaaacaacaattca |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1252953 |
ccattgtattccttgttttgaaagaattatttgatgttaactctgttagtcataagttaacagttggaaaaccttagtttgtctcaaaaacaacaattca |
1252854 |
T |
|
| Q |
332 |
t |
332 |
Q |
| |
|
| |
|
|
| T |
1252853 |
t |
1252853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 267 - 304
Target Start/End: Original strand, 11006003 - 11006040
Alignment:
| Q |
267 |
gttaactctgttagtcataagttaacagttggaaaacc |
304 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
11006003 |
gttaactctgttagtcataagttaacgattggaaaacc |
11006040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University