View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5972-Insertion-11 (Length: 365)
Name: NF5972-Insertion-11
Description: NF5972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5972-Insertion-11 |
 |  |
|
| [»] chr1 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-103; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 171 - 365
Target Start/End: Original strand, 31067894 - 31068088
Alignment:
| Q |
171 |
gaaccagtcttattcattaatattgcatcactaatataatatagctgggtagctagttatcctatttttggcattcgagtgactctcccatgtttgtcga |
270 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31067894 |
gaaccagtcttatttattaatattgcatcactaatataatatagctgggtagctagttatcctatttttggcattcgagtgactctcccatgtttgtcga |
31067993 |
T |
 |
| Q |
271 |
cccaaacccaaaccctagtgcacttgaaatccattgtcacaacagacccttctggcaccactattgcattcactttctcattctctctttctatc |
365 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31067994 |
cccaaacccaaaccctagtgcacttgaaatccattgtcacaacagacccttctggcaccactattgcattcactttctcattctctctttctatc |
31068088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 176 - 361
Target Start/End: Original strand, 31059230 - 31059408
Alignment:
| Q |
176 |
agtcttattcattaatattgcatcactaatataatatagctgggtagctagttatcctatttttggcattcgagtgactctcccatgtttgtcgacccaa |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |||| |||| | ||||||||||||| |
|
|
| T |
31059230 |
agtcttattcattaatattgcatcactaata-------gctgggtagctagttatcctatttttggcactcgaaagactttcccttctttgtcgacccaa |
31059322 |
T |
 |
| Q |
276 |
acccaaaccctagtgcacttgaaatccattgtcacaacagacccttctggcaccactattgcattcactttctcattctctctttc |
361 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||| ||||||||| ||||||||||||||||||||| | | |||||||||||| |
|
|
| T |
31059323 |
acccaaaccctagtgcacttgaaattcattggcacaagagacccttccggcaccactattgcattcactctatgattctctctttc |
31059408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 36 - 122
Target Start/End: Original strand, 31067759 - 31067838
Alignment:
| Q |
36 |
tggaagacattgataatgatcatttttgctagctactagctagccacccccatagttttaaactgggcactatgttacatgatacat |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31067759 |
tggaagacattgataatgatcatttttgctagcca-------gccacccccatagttttaaactgggcactatgttacatgatacat |
31067838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 41 - 70
Target Start/End: Original strand, 31059190 - 31059219
Alignment:
| Q |
41 |
gacattgataatgatcatttttgctagcta |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31059190 |
gacattgataatgatcatttttgctagcta |
31059219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University