View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5972_high_17 (Length: 377)
Name: NF5972_high_17
Description: NF5972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5972_high_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 18 - 369
Target Start/End: Original strand, 30742318 - 30742669
Alignment:
| Q |
18 |
aagatttaatttcaaaatgtagcccaaaatttcatgaggctttcaagtaaagaacctcaacatcaccctcatcaccatcatgatggatcttctttaaaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30742318 |
aagatttaatttcaaaatgtagcccaaaatttcatgaggctttcaagtaaagaacctcaacatcaccctcatcaccatcatgatggatcttctttaaaaa |
30742417 |
T |
 |
| Q |
118 |
acaaatttcaccattgtttaagtgagcaacatgaacagccatacattgcataccatgtatataaccatctcttaaccttttccatagatttgttgataac |
217 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30742418 |
acaaatttcaccattgttcaagtgagaaacatgaacagccatacattgcataccatgtatataaccatctcttaaccttttccatagatttgttgataac |
30742517 |
T |
 |
| Q |
218 |
cttaagatctttggttgaactttttccatcatttcaaaaaagttcaaattctttgaacctaacatagcaacattttcattaatattgcaatcactcacct |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30742518 |
cttaagatctttggttgaactttttccatcatttcaaaaaagttcaaattctttgaacctaacatagcaacattttcattaatagtgcaatcactcacct |
30742617 |
T |
 |
| Q |
318 |
ctttgttgctcttgagcttatggtatatttttctctttgtgtaccctatgct |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30742618 |
ctttgttgctcttgagcttatggtatatttttctctttgtgtaccttatgct |
30742669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University