View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5972_high_27 (Length: 270)
Name: NF5972_high_27
Description: NF5972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5972_high_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 17 - 254
Target Start/End: Original strand, 3426178 - 3426417
Alignment:
| Q |
17 |
atgaagaagaagattaattgaggggacatgacataataagtgagaaagtggattcacctattttctaactgtagccagcttttttaaacttcaattttcc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3426178 |
atgaagaagaagattaattgaggggacatgacataataagtgagaaagtggattcacctattttctaactgtagccagcttttttaaatttcaattttcc |
3426277 |
T |
|
| Q |
117 |
ttcttttgatttatatctttaaataattcattattgcctaaaatatttgttgattcttatgtattcgaatcattaatgtattac--tgtatgagttcaat |
214 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| ||||||| |||||| |
|
|
| T |
3426278 |
ttcttttgatttacatctttaaataattcattattgcctaaaatatttgtcgattcttatgtattcgaatcattaatgtagtactatgtatgaattcaat |
3426377 |
T |
|
| Q |
215 |
ctttagctaggataactctgtcaaattttatatatctctt |
254 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
3426378 |
ctttggctaggataactctgtcaaattttatatctctctt |
3426417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University