View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5972_high_30 (Length: 267)
Name: NF5972_high_30
Description: NF5972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5972_high_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 250
Target Start/End: Original strand, 35740446 - 35740606
Alignment:
| Q |
90 |
ttcggcgcgaacgaccacaccaaatgaaggcgcaccaacccaagccgccggagcctctacgaacaaacagctcaccggtgatagaaaacccgcgaataga |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35740446 |
ttcggcgcgaacgaccacaccaaatgaaggcgcaccaacccaagccgctggagcctctacgaacaaatagctcaccggtgatagaaaacccgcgaataga |
35740545 |
T |
 |
| Q |
190 |
aacagccggcgaaaacatgtgttagcaagcaatttgaatcgagtcattaatttgagttcca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35740546 |
aacagccggcgaaaacatgtgttagcaagcaatttgaatcgagtcattaatttgagttcca |
35740606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University