View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5972_high_31 (Length: 266)
Name: NF5972_high_31
Description: NF5972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5972_high_31 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 16 - 266
Target Start/End: Original strand, 53089344 - 53089594
Alignment:
| Q |
16 |
acttttcacttcaaaggttgttaaattctcaacaaacttcacgtcttcagtttctgatgattccacttgatgtttttcagtttcacgttgcttcaattgt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53089344 |
acttttcacttcaaaggttgttaaattctcaacaaacttcacgtcttcagtttctgatgattccacttgatgtttttcagtttcacgttgcttcaattgt |
53089443 |
T |
|
| Q |
116 |
tcgagctcttgcttcgtgcgttcgagttcttcctgaagagatgacatacaatgtgccatcaacatgctttcttctttagctttctctagattttctcgtg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53089444 |
tcgagctcttgcttcgtgcgttcgagttcttcctgaagagatgacatacaatgtgccatcaacatgctttcttctttagctttctctagattttctcgtg |
53089543 |
T |
|
| Q |
216 |
tttcctccagctcagctgtaacgttttcaacccttgaagactgatcaaccc |
266 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53089544 |
tctcctccagctcagctgtaacgttttcaacccttgaagactgatcaaccc |
53089594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 16 - 82
Target Start/End: Original strand, 14334053 - 14334119
Alignment:
| Q |
16 |
acttttcacttcaaaggttgttaaattctcaacaaacttcacgtcttcagtttctgatgattccact |
82 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14334053 |
acttttcagttcaaaggttgttaaattctcaacaaacttcacgtcttcagtttctgatgatttcact |
14334119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University