View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5972_low_29 (Length: 267)
Name: NF5972_low_29
Description: NF5972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5972_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 19 - 258
Target Start/End: Original strand, 42336336 - 42336575
Alignment:
| Q |
19 |
aaggcgcgttagggttaggagatggggctggtgatgtgggagatgaagctggagaagacccagcaggggctggtgccggtgaaggcgactggcctccgac |
118 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
42336336 |
aaggcgcattagggttaggagatggggttggtgatgtgggagatgaagctggagaagaaccagcgggggctggtgccggtgaaggcgactggcctacgac |
42336435 |
T |
 |
| Q |
119 |
accggcgataacaatgcagatgaatgcaagagagaacacaatgttgagattcattttgaaaattgaaaacaaggtgnnnnnnnnnnnngtttgctagggt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42336436 |
accggcgataacaatgcagatgaatgcaagagagaacacaatgttgagattcattttgaaaattgaaaacaaggtgtttttcttttttgtttgctagggt |
42336535 |
T |
 |
| Q |
219 |
tgcaatgtgatgataaaaggcttatacttgatagtattat |
258 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42336536 |
tgcaatgtgatgatgaaaggcttatacttgatagtattat |
42336575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 108 - 156
Target Start/End: Complemental strand, 19792394 - 19792346
Alignment:
| Q |
108 |
tggcctccgacaccggcgataacaatgcagatgaatgcaagagagaaca |
156 |
Q |
| |
|
||||||| |||| |||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
19792394 |
tggcctctgacagcggcgacaacaatgcagatgagtgcaaaagagaaca |
19792346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University