View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5972_low_38 (Length: 236)
Name: NF5972_low_38
Description: NF5972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5972_low_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 50385067 - 50384967
Alignment:
| Q |
1 |
aatcaaagaggataaaatgataaacatgataggttgatgattgattggaagatagatggagaaaatggggaataaattttctccaatggtaatctatcga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
50385067 |
aatcaaagaggataaaatgataaacatgataggttgatgattgattggaagatagatagagaaaatggggaataaatttcctccaatggtaatctatcga |
50384968 |
T |
|
| Q |
101 |
g |
101 |
Q |
| |
|
| |
|
|
| T |
50384967 |
g |
50384967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 124 - 220
Target Start/End: Complemental strand, 50384938 - 50384842
Alignment:
| Q |
124 |
gagcatctataccattaaacaatttatctctcttgatttctatatttcgttctctgtatttannnnnnncaatggtcgtgttttcactagatcatgc |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |||||| ||||||||||||||||||| |||||||| |
|
|
| T |
50384938 |
gagcatctataccattaaacaatttatctcttttgatttcttaatttcgttctctatatttatttttttcaatggtcgtgttttcactggatcatgc |
50384842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University