View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5972_low_40 (Length: 234)
Name: NF5972_low_40
Description: NF5972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5972_low_40 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 218
Target Start/End: Complemental strand, 43544148 - 43543947
Alignment:
| Q |
17 |
atgaaagccctgtcaaagcagaacccacccaaaatcttatgaaatcatcgctactcttagaatttggatttgtttaaattcaatcccagaaaacaggctt |
116 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43544148 |
atgaaagccctttcaaagcagaacccaaccaaaatcttatgaaatcatcgctactcttagaatttggatttgtttaaattcaatccaagaaaacaggctt |
43544049 |
T |
|
| Q |
117 |
gtaagatgaaggaatcatcccctcacactcaagcgggtagaacaacagattttgtataggctctaataccatcttagaatctaggttgagccaaattcaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43544048 |
gtaagatgaaggaatcatcccctcacactcaagcgggtagaacaacagattttgtataggctctaataccatcttagaatctaggttgagccaaattcaa |
43543949 |
T |
|
| Q |
217 |
cc |
218 |
Q |
| |
|
|| |
|
|
| T |
43543948 |
cc |
43543947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 218
Target Start/End: Complemental strand, 2115368 - 2115323
Alignment:
| Q |
173 |
taggctctaataccatcttagaatctaggttgagccaaattcaacc |
218 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||| || |||||| |
|
|
| T |
2115368 |
taggctctaataccatcttagaattttggttgagcctaactcaacc |
2115323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 216
Target Start/End: Original strand, 49190149 - 49190206
Alignment:
| Q |
159 |
caacagattttgtataggctctaataccatcttagaatctaggttgagccaaattcaa |
216 |
Q |
| |
|
|||| ||| ||| ||||||||| ||||||||||||||| | |||||||||||| |||| |
|
|
| T |
49190149 |
caacggatcttggataggctctgataccatcttagaatttgggttgagccaaactcaa |
49190206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University