View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5972_low_43 (Length: 217)
Name: NF5972_low_43
Description: NF5972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5972_low_43 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 134 - 201
Target Start/End: Original strand, 5657693 - 5657760
Alignment:
| Q |
134 |
tgaaatagttcagatacaaataaaatatattaaacatttaaattattaaattctaaaccattgttcct |
201 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5657693 |
tgaaatagttcagatacatataaaatatattgaacctttaaattattaaattctaaaccattgttcct |
5657760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 5657640 - 5657691
Alignment:
| Q |
18 |
ataaaatgacactgtaatattgttgaaa--ctcaagtgtaatttttgtcaaa |
67 |
Q |
| |
|
||||||||||||||| |||||||||||| ||| |||||| ||||||||||| |
|
|
| T |
5657640 |
ataaaatgacactgtgatattgttgaaactctcgagtgtattttttgtcaaa |
5657691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University