View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5972_low_43 (Length: 217)

Name: NF5972_low_43
Description: NF5972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5972_low_43
NF5972_low_43
[»] chr6 (2 HSPs)
chr6 (134-201)||(5657693-5657760)
chr6 (18-67)||(5657640-5657691)


Alignment Details
Target: chr6 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 134 - 201
Target Start/End: Original strand, 5657693 - 5657760
Alignment:
134 tgaaatagttcagatacaaataaaatatattaaacatttaaattattaaattctaaaccattgttcct 201  Q
    |||||||||||||||||| |||||||||||| ||| ||||||||||||||||||||||||||||||||    
5657693 tgaaatagttcagatacatataaaatatattgaacctttaaattattaaattctaaaccattgttcct 5657760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 5657640 - 5657691
Alignment:
18 ataaaatgacactgtaatattgttgaaa--ctcaagtgtaatttttgtcaaa 67  Q
    ||||||||||||||| ||||||||||||  ||| |||||| |||||||||||    
5657640 ataaaatgacactgtgatattgttgaaactctcgagtgtattttttgtcaaa 5657691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University