View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5972_low_45 (Length: 205)
Name: NF5972_low_45
Description: NF5972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5972_low_45 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 2 - 205
Target Start/End: Complemental strand, 18230082 - 18229879
Alignment:
| Q |
2 |
atttgattttctagctcttatttcttgaatgcgatttcgatgtttcttttttgtgcaaatcaatagatgaagtcgatagtttctaagccatgatagacaa |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18230082 |
atttgattttctagctcttatttcttgaatgcgatttcgatgtttcttttttgtgcaaatcaatagatgaagtcgatagtttctaagccatgatagacaa |
18229983 |
T |
|
| Q |
102 |
ccacaacagataactcttttgccctttctttaacacccgctctcttattggatcgaagtttcacacaataaaatagtaaatgttaaaattagtgtgttgc |
201 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
18229982 |
ccacaacagagaactcttttgccctttctttaacatccgctctcttattggatcgaagtttcacacaataaaatagtgaatgttaaaattatagtgttgc |
18229883 |
T |
|
| Q |
202 |
attt |
205 |
Q |
| |
|
|||| |
|
|
| T |
18229882 |
attt |
18229879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University