View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5973_high_14 (Length: 250)
Name: NF5973_high_14
Description: NF5973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5973_high_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 129 - 235
Target Start/End: Complemental strand, 7604877 - 7604771
Alignment:
| Q |
129 |
cacctggtctccgataggaatagcaacttgacaatcacacaaagaacttcccctcacgcagtgcacgcgccaccgtccggtgacagttacaaacgccgta |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7604877 |
cacctggtctccgataggaatagcaacttgacaatcacacaaagaacttcccctcacgcagtgcacgcgccaccgtccggtgacagttacaaacgccgta |
7604778 |
T |
|
| Q |
229 |
tccaaac |
235 |
Q |
| |
|
||||||| |
|
|
| T |
7604777 |
tccaaac |
7604771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 7605035 - 7604990
Alignment:
| Q |
1 |
aaaaacttactttgtattgatgagtttaataactttagattgaatt |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7605035 |
aaaaacttactttgtattgatgagtttaataactttagattgaatt |
7604990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University