View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5973_high_16 (Length: 235)
Name: NF5973_high_16
Description: NF5973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5973_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 13 - 214
Target Start/End: Original strand, 52675017 - 52675218
Alignment:
| Q |
13 |
aagaatatcaataaaagaagataaaacacacacccattaagaggctcgtgctaacatttaattagacgaagcattagacaacatgaaagttgcgaaaccg |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
52675017 |
aagaaaatcaataaaagaagataaaacacacacccattgagaggctcgtgctaacatttaattagacgaggcattagacaacatggaagttgcgaaaccg |
52675116 |
T |
 |
| Q |
113 |
aagtgaaatcaaagcagattgtcaaacctacatgggatggaatcttgtggtgatttccgtaaagaggaaggaggagaaggtggcgatttccacatgcatc |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
52675117 |
aagtgaaatcaaagcagattatcaaacctacatgggatggaatcttgtggtgatttccgtaaagaggaaggaggagaaggtggcgatttccatatgcatc |
52675216 |
T |
 |
| Q |
213 |
gt |
214 |
Q |
| |
|
|| |
|
|
| T |
52675217 |
gt |
52675218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University