View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5973_low_13 (Length: 251)
Name: NF5973_low_13
Description: NF5973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5973_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 7 - 213
Target Start/End: Complemental strand, 612734 - 612528
Alignment:
| Q |
7 |
tcgaaaaatatccattgctctttgcctcattttccaaacttgttcaaaatcccgatcaaaggttatggaaatgacaaccttaatgaatctctccttgatc |
106 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
612734 |
tcgaagaaaatccattgctctttgcctcattttccaaacttgttcaaaatcccgatcaaaggttatggaaatgacaaccttaatgaatctctccttgatc |
612635 |
T |
 |
| Q |
107 |
ggcttcaaaacaagtttttcttcaaatagtttgtttctctttgcctgcgtatgggagtaacacaattatataatttttgactcaaatatacacacacctc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
612634 |
ggcttcaaaacaagtttttcttcaaatagtttgtttctctttgcctgcgtatgggagtaacacaattatataatttttgactcaaatatacacacacctc |
612535 |
T |
 |
| Q |
207 |
tcatatg |
213 |
Q |
| |
|
||||||| |
|
|
| T |
612534 |
tcatatg |
612528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 222 - 251
Target Start/End: Complemental strand, 612499 - 612470
Alignment:
| Q |
222 |
gtatagaaataactcatgaatttgaaaaat |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
612499 |
gtatagaaataactcatgaatttgaaaaat |
612470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 102
Target Start/End: Original strand, 37477643 - 37477683
Alignment:
| Q |
62 |
tcaaaggttatggaaatgacaaccttaatgaatctctcctt |
102 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
37477643 |
tcaacggttatggaaatgacaaccttgatgaatctttcctt |
37477683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University