View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5975-Insertion-19 (Length: 205)
Name: NF5975-Insertion-19
Description: NF5975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5975-Insertion-19 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 12 - 205
Target Start/End: Original strand, 39754484 - 39754678
Alignment:
| Q |
12 |
ttatccatagacatcgatctctcggcgatcttgccactgttcccctgccgaaaacacagcagcagttgcctctgca-gccttcctccactgatcacattg |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
39754484 |
ttatccgtagacatcgatctctcggcgatcttgccactgttcccctgccgaaaacacagcagcagttgcctctgcaagcctttctccactgatcacattg |
39754583 |
T |
|
| Q |
111 |
cactttgattattttcaattcatcttctttttccgtattctccacctgtgcagcttccaactgctcagccaccctcaccaccttactgttgctct |
205 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39754584 |
cactttgattcttttcaattcatcttctttttccgtattcgccacctgtgcagcttccaactgctcagccaccctcaccaccttactattgctct |
39754678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 8 - 197
Target Start/End: Original strand, 39763444 - 39763632
Alignment:
| Q |
8 |
attgttatccatagacatcgatctctcggcgatcttgccactgttcccctgccgaaaacacagcagcagttgcctctgcagccttcctccactgatcaca |
107 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||| || ||||||| ||| ||||||| |||||| | ||| |||||||||||||||||||||||||| |
|
|
| T |
39763444 |
attgttgtccatagacatcgatctctcagcgatctttccgttgttccc-tgctgaaaacatagcagctgctgcttctgcagccttcctccactgatcaca |
39763542 |
T |
|
| Q |
108 |
ttgcactttgattattttcaattcatcttctttttccgtattctccacctgtgcagcttccaactgctcagccaccctcaccaccttact |
197 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| ||||| |||| |||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
39763543 |
ttgcactttgattcttttcaattcatcttctttttccatattcgccacttgtgcagcttccaactgctcagccaccctcgccgccttact |
39763632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 54 - 105
Target Start/End: Complemental strand, 22473119 - 22473068
Alignment:
| Q |
54 |
ccctgccgaaaacacagcagcagttgcctctgcagccttcctccactgatca |
105 |
Q |
| |
|
||||||||||| || |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
22473119 |
ccctgccgaaatcatagcagcagctgcctctgcagccttcctccattgatca |
22473068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University