View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5975-Insertion-20 (Length: 124)
Name: NF5975-Insertion-20
Description: NF5975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5975-Insertion-20 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 1e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 8 - 124
Target Start/End: Complemental strand, 53623628 - 53623512
Alignment:
| Q |
8 |
actcgaccgattcttcactggatctgttccacttttcgtccttccaatagtatctccctctctgaaatctctcagttcgttactctcttcatcttcttca |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53623628 |
actcaaccgattcttcactggatctgttccacttttcgtccttccaatagtatctccctctctgaaatctctcagttcgttactctcttcatcttcttca |
53623529 |
T |
|
| Q |
108 |
atttttgctatttacac |
124 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
53623528 |
atttttgctatttacac |
53623512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 7e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 7e-22
Query Start/End: Original strand, 7 - 91
Target Start/End: Complemental strand, 14226810 - 14226726
Alignment:
| Q |
7 |
cactcgaccgattcttcactggatctgttccacttttcgtccttccaatagtatctccctctctgaaatctctcagttcgttact |
91 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||| ||||||||||||||| | |||||||||| ||| |||||||||| |||||| |
|
|
| T |
14226810 |
cactcgaccgattcttcattggatctgctccactcttcgtccttccaatattctctccctctccgaactctctcagtttgttact |
14226726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 80 - 124
Target Start/End: Original strand, 27850208 - 27850252
Alignment:
| Q |
80 |
cagttcgttactctcttcatcttcttcaatttttgctatttacac |
124 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27850208 |
cagttcgttaccctcttcatcttcttcaatttttgctatttacac |
27850252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University