View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5975-Insertion-21 (Length: 123)
Name: NF5975-Insertion-21
Description: NF5975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5975-Insertion-21 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 7e-59; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 7e-59
Query Start/End: Original strand, 9 - 123
Target Start/End: Complemental strand, 34763893 - 34763779
Alignment:
| Q |
9 |
ggttccatgcctaccgttgttgcatccactcctgacttgtttaaacttttccttcaaacccatgaagctacttcctttaacacaagattccaaacctctg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34763893 |
ggttccatgcctaccgttgttgcatccactcctgacttgtttaaacttttccttcaaacccatgaagctacttcctttaacacaagattccaaacctctg |
34763794 |
T |
 |
| Q |
109 |
ctattagtcgtctta |
123 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
34763793 |
ctattagtcgtctta |
34763779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 115; E-Value: 7e-59
Query Start/End: Original strand, 9 - 123
Target Start/End: Original strand, 34780219 - 34780333
Alignment:
| Q |
9 |
ggttccatgcctaccgttgttgcatccactcctgacttgtttaaacttttccttcaaacccatgaagctacttcctttaacacaagattccaaacctctg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34780219 |
ggttccatgcctaccgttgttgcatccactcctgacttgtttaaacttttccttcaaacccatgaagctacttcctttaacacaagattccaaacctctg |
34780318 |
T |
 |
| Q |
109 |
ctattagtcgtctta |
123 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
34780319 |
ctattagtcgtctta |
34780333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 95; E-Value: 6e-47
Query Start/End: Original strand, 9 - 123
Target Start/End: Complemental strand, 34755917 - 34755803
Alignment:
| Q |
9 |
ggttccatgcctaccgttgttgcatccactcctgacttgtttaaacttttccttcaaacccatgaagctacttcctttaacacaagattccaaacctctg |
108 |
Q |
| |
|
||||||||||||||| ||||||| || || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34755917 |
ggttccatgcctaccattgttgcctcaacccctgacttgtttaaacttttccttcaaacccatgaagctacttcctttaacacaaggttccaaacctctg |
34755818 |
T |
 |
| Q |
109 |
ctattagtcgtctta |
123 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
34755817 |
ctattagtcgtctta |
34755803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University