View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5975-Insertion-23 (Length: 100)
Name: NF5975-Insertion-23
Description: NF5975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5975-Insertion-23 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 92; Significance: 3e-45; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 92; E-Value: 3e-45
Query Start/End: Original strand, 9 - 100
Target Start/End: Complemental strand, 26935894 - 26935803
Alignment:
| Q |
9 |
agcattacatcagttggaaaattgaaactttgccatttgatattgttgaattcatccacaagcacaagatttcctgtgttcagtatttgcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26935894 |
agcattacatcagttggaaaattgaaactttgccatttgatattgttgaattcatccacaagcacaagatttcctgtgttcagtatttgcaa |
26935803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University