View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5975_high_10 (Length: 437)
Name: NF5975_high_10
Description: NF5975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5975_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-109; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 18185086 - 18185309
Alignment:
| Q |
1 |
tcattgtagtatccatgtataagtttctgtcaaagtaaccctctcgcgcacatgcttttgatcattgtagctgtttgaaatatcagtaggttcgagtgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18185086 |
tcattgtagtatccatgtataagtttctgtcaa-gtaaccctctcgcgcacatgcttttgatcattgtagctgtttgaaatatcagtgggttcgagtgtt |
18185184 |
T |
|
| Q |
101 |
gattgatttcttatggccaatgacatggaacatgccgagggcaggattgttccatttgaagggtacattttattttcagttgtaacccctatgagggaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18185185 |
gattgatttcttatggccaatgacatggaacatgccgagggcaggattgctccatccgaagggtacattttattttcagttgtaacccctatgagggaaa |
18185284 |
T |
|
| Q |
201 |
gaaatttttttgcaacccctatgag |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
18185285 |
gaaatttttttgcaacccctatgag |
18185309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 332 - 423
Target Start/End: Original strand, 18185307 - 18185394
Alignment:
| Q |
332 |
gagattgcgtattagcgtgtttgcattgcgcacgtacatatgacttggaattggataataacatggtaagttataatccctttgttagtaat |
423 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
18185307 |
gagattgcgtaggagcgtgtttgcattgcgcac----atatgacttggaattggataataacatcgtaagttataatccctttgttagtaat |
18185394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University