View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5975_high_24 (Length: 308)
Name: NF5975_high_24
Description: NF5975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5975_high_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 1 - 289
Target Start/End: Original strand, 40585644 - 40585932
Alignment:
| Q |
1 |
taacctgcgttcgtttactctcggactcatgtcttttggcatctttcttatgggatttggagaggaggaggccgagttagaaccagagtttggtgtcttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40585644 |
taacctgcgttcgtttactctcggactcatgtcttttggcgtctttcttatgggatttggagaggaggaggccgagttagaaccagagtttggtgtcttc |
40585743 |
T |
 |
| Q |
101 |
aactggcgagcagttcgaggggttgcagcaggtgatttcctttgggacatttctggagcactggatctgccagcaataagccaattagaatgaataataa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40585744 |
aactggcgagcagttcgaggggttgcagcaggtgatttcctttgggacatttctggagcactggatctgccagcaataagccaattagaatgaataataa |
40585843 |
T |
 |
| Q |
201 |
aatgtataataaacataaatccaaaccataacacgctgaagtggtcaagtgaggagaatcgatcatctggaggaagctatgcaacgctt |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40585844 |
aatgtataataaacataaatccaaaccataaaacgctgaagtggtcaagtgaggagaatcaatcatctggaggaagctatgcaacgctt |
40585932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University