View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5975_high_25 (Length: 307)
Name: NF5975_high_25
Description: NF5975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5975_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 12 - 287
Target Start/End: Complemental strand, 6611661 - 6611386
Alignment:
| Q |
12 |
atccaaaaatagagggtatgtaagcattctttattttcctctaaaagaaaagttctttatttttctctaacctaatctttaatttctcatgtgcagaacg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6611661 |
atccaaaaatagagggtatgtaagcattctttattttcctctgaaagaaaagttctttatttttctctaacctaatctttaatttctcatgtgcagaacg |
6611562 |
T |
 |
| Q |
112 |
tgggatatattgagattcaatttaattaaagggacacccatacatataaaccccactattcttaattggagtccaagtaagaaatcaaagatcaagatag |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6611561 |
tgggatatattgagattcaatttaattaaagggacactcatacatataaaccccactattcttcattggagtccaagtaggaaatcaaagatcaagatag |
6611462 |
T |
 |
| Q |
212 |
attactttcagtggttttgagtattatgcctttagtttatatcatattgtccatttggaacattagatttgggtag |
287 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6611461 |
attactttcagtggctttgagtattatgcctttagtttatatcatattgtccatttggaacattagattagggtag |
6611386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University