View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5975_high_52 (Length: 228)
Name: NF5975_high_52
Description: NF5975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5975_high_52 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 35 - 228
Target Start/End: Original strand, 41451461 - 41451654
Alignment:
| Q |
35 |
ttgaatacttgtatgaggattttgacatgtatnnnnnnngtgtcatacattggacaccaacgcgggttgaacaacgcgacacacaagcatattaaattac |
134 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41451461 |
ttgaatacttgtatgaggtttttgacatgtataaaaaaagtgtcatacattggacaccaacgcgggttgaacaccgcgacacacaagcatattaaattac |
41451560 |
T |
|
| Q |
135 |
acgatcatacaaatcgcaccctatagctttctctgaaagatatctttttctgtttaattcaaagtccaagcatatatatccagtatagttaaaa |
228 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| | |||||||||||| |||||||||||||||| ||||||||| || | |||| |||||||| |
|
|
| T |
41451561 |
acgatcatacaaatcgcaccctataggtttctcaggaagatatcttttgctgtttaattcaaagttcaagcatatgtacctagtacagttaaaa |
41451654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University