View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5975_high_54 (Length: 217)
Name: NF5975_high_54
Description: NF5975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5975_high_54 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 39754678 - 39754484
Alignment:
| Q |
1 |
agagcaacagtaaggtggtgagggtggctgagcagttggaagctgcacaggtggagaatacggaaaaagaagatgaattgaaaataatcaaagtgcaatg |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39754678 |
agagcaatagtaaggtggtgagggtggctgagcagttggaagctgcacaggtggcgaatacggaaaaagaagatgaattgaaaagaatcaaagtgcaatg |
39754579 |
T |
|
| Q |
101 |
tgatcagtggaggaaggc-tgcagaggcaactgctgctgtgttttcggcaggggaacagtggcaagatcgccgagagatcgatgtctatggataa |
194 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39754578 |
tgatcagtggagaaaggcttgcagaggcaactgctgctgtgttttcggcaggggaacagtggcaagatcgccgagagatcgatgtctacggataa |
39754484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 9 - 198
Target Start/End: Complemental strand, 39763632 - 39763444
Alignment:
| Q |
9 |
agtaaggtggtgagggtggctgagcagttggaagctgcacaggtggagaatacggaaaaagaagatgaattgaaaataatcaaagtgcaatgtgatcagt |
108 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||| |||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39763632 |
agtaaggcggcgagggtggctgagcagttggaagctgcacaagtggcgaatatggaaaaagaagatgaattgaaaagaatcaaagtgcaatgtgatcagt |
39763533 |
T |
|
| Q |
109 |
ggaggaaggctgcagaggcaactgctgctgtgttttcggcaggggaacagtggcaagatcgccgagagatcgatgtctatggataacaat |
198 |
Q |
| |
|
|||||||||||||||| ||| | |||||| ||||||| ||| ||||||| || |||||||| |||||||||||||||||||| |||||| |
|
|
| T |
39763532 |
ggaggaaggctgcagaagcagcagctgctatgttttcagca-gggaacaacggaaagatcgctgagagatcgatgtctatggacaacaat |
39763444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 101 - 152
Target Start/End: Original strand, 22473068 - 22473119
Alignment:
| Q |
101 |
tgatcagtggaggaaggctgcagaggcaactgctgctgtgttttcggcaggg |
152 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||| || ||||||||||| |
|
|
| T |
22473068 |
tgatcaatggaggaaggctgcagaggcagctgctgctatgatttcggcaggg |
22473119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University