View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5975_low_21 (Length: 341)

Name: NF5975_low_21
Description: NF5975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5975_low_21
NF5975_low_21
[»] chr3 (6 HSPs)
chr3 (4-335)||(4530209-4530544)
chr3 (192-317)||(4498958-4499084)
chr3 (192-335)||(4397592-4397732)
chr3 (263-335)||(4520027-4520099)
chr3 (51-106)||(4499433-4499488)
chr3 (51-102)||(4520878-4520929)
[»] chr4 (2 HSPs)
chr4 (201-317)||(18033394-18033511)
chr4 (192-335)||(18047594-18047734)


Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 6)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 4 - 335
Target Start/End: Complemental strand, 4530544 - 4530209
Alignment:
4 atgtcgaagaatattaatcgatttaagagagtatat--tcaaaaccacatccatgattgaggaaagatttt-gacacaagtaaaatacttgaataatgat 100  Q
    |||||| | |||||||||||||||||||||||||||  |||||| |||||||||||||||||||||||||| ||| |||||||||||||||| |||||||    
4530544 atgtcgtaaaatattaatcgatttaagagagtatatattcaaaaacacatccatgattgaggaaagatttttgactcaagtaaaatacttgagtaatgat 4530445  T
101 ggtctcataggaaggatctcaacttttcggatgcaagagactttacgccagttttttccatatggttttgcatatctttcctctaataatgagcagttat 200  Q
    |||||||||||||||||||||||||||||||||| ||||| ||||||||||| ||  |||||||||||||||||||||||||||||||||||||||||||    
4530444 ggtctcataggaaggatctcaacttttcggatgcgagagattttacgccagtcttgaccatatggttttgcatatctttcctctaataatgagcagttat 4530345  T
201 aaatgcaaagtttctgcaaagatacaaggttatgtattgcttcgggcagtgatgt-aaaccattgcaattgtggaactcaagggtcaagagcgatgagag 299  Q
    | |||||||||||||||||||||||||||||| | || ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||    
4530344 acatgcaaagtttctgcaaagatacaaggttacgcatcgcttcgggcagtgatgtcaaaccattgcaattgtggaactcaagagtcaagagcgatgagag 4530245  T
300 attccctatccagtctggcaatcttttgccgcaaaa 335  Q
    |||||||||||||||||| ||  |||||||||||||    
4530244 attccctatccagtctggtaactttttgccgcaaaa 4530209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 192 - 317
Target Start/End: Complemental strand, 4499084 - 4498958
Alignment:
192 agcagttataaatgcaaagtttctgcaaagatacaaggttatgtattgcttcgggcagtgatgt-aaaccattgcaattgtggaactcaagggtcaagag 290  Q
    |||||||| ||||||||||||||||||||||||||||||||   ||| |||||||||||||||| |||| ||||||||||||||||||||| ||||||||    
4499084 agcagttagaaatgcaaagtttctgcaaagatacaaggttactcatttcttcgggcagtgatgtcaaactattgcaattgtggaactcaagagtcaagag 4498985  T
291 cgatgagagattccctatccagtctgg 317  Q
    ||||||||||||||  |||||||||||    
4498984 cgatgagagattccacatccagtctgg 4498958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 192 - 335
Target Start/End: Original strand, 4397592 - 4397732
Alignment:
192 agcagttataaatgcaaagtttctgcaaagatacaaggttatgtattgcttcgggcagtgatgt-aaaccattgcaattgtggaactcaagggtcaagag 290  Q
    |||||||| |||||||||| | || ||||||||||||||||   |   |||| |||||| |||| |||| |||||||||||||| |||||| ||||||||    
4397592 agcagttagaaatgcaaaggt-cttcaaagatacaaggttacaca---cttccggcagtaatgtcaaactattgcaattgtggatctcaagagtcaagag 4397687  T
291 cgatgagagattccctatccagtctggcaatcttttgccgcaaaa 335  Q
    |||||||||||||| |||||||||||| || ||  ||||||||||    
4397688 cgatgagagattccatatccagtctggtaacctgctgccgcaaaa 4397732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 263 - 335
Target Start/End: Complemental strand, 4520099 - 4520027
Alignment:
263 tgcaattgtggaactcaagggtcaagagcgatgagagattccctatccagtctggcaatcttttgccgcaaaa 335  Q
    ||||||||||||||||||| |||||||||||||||||||| | |||||||||||| ||  |||||||||||||    
4520099 tgcaattgtggaactcaagagtcaagagcgatgagagattacatatccagtctggtaactttttgccgcaaaa 4520027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 51 - 106
Target Start/End: Complemental strand, 4499488 - 4499433
Alignment:
51 tccatgattgaggaaagattttgacacaagtaaaatacttgaataatgatggtctc 106  Q
    ||||||||||||||||||||||||| |||||||||||||||| |||||||||||||    
4499488 tccatgattgaggaaagattttgactcaagtaaaatacttgagtaatgatggtctc 4499433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 51 - 102
Target Start/End: Complemental strand, 4520929 - 4520878
Alignment:
51 tccatgattgaggaaagattttgacacaagtaaaatacttgaataatgatgg 102  Q
    ||||||||||| ||||||||||||| |||| ||||||||||| |||||||||    
4520929 tccatgattgatgaaagattttgactcaagaaaaatacttgagtaatgatgg 4520878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 78; Significance: 3e-36; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 201 - 317
Target Start/End: Original strand, 18033394 - 18033511
Alignment:
201 aaatgcaaagtttctgcaaagatacaaggttatgtattgcttcgggcagtgatgt-aaaccattgcaattgtggaactcaagggtcaagagcgatgagag 299  Q
    ||||||||||||||||||||||||||||||||   ||| |||||||||||||||| |||| ||||||||||||||||||||| |||||||||||||||||    
18033394 aaatgcaaagtttctgcaaagatacaaggttactcatttcttcgggcagtgatgtcaaactattgcaattgtggaactcaagagtcaagagcgatgagag 18033493  T
300 attccctatccagtctgg 317  Q
    |||||  |||||||||||    
18033494 attccacatccagtctgg 18033511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 192 - 335
Target Start/End: Complemental strand, 18047734 - 18047594
Alignment:
192 agcagttataaatgcaaagtttctgcaaagatacaaggttatgtattgcttcgggcagtgatgt-aaaccattgcaattgtggaactcaagggtcaagag 290  Q
    |||||||| |||||||||| | || ||||||||||||||||   |   |||| |||||| |||| |||| |||||||||||||| |||||| ||||||||    
18047734 agcagttagaaatgcaaaggt-cttcaaagatacaaggttacaca---cttccggcagtaatgtcaaactattgcaattgtggatctcaagagtcaagag 18047639  T
291 cgatgagagattccctatccagtctggcaatcttttgccgcaaaa 335  Q
    |||||||||||||| |||||||||||| || ||  ||||||||||    
18047638 cgatgagagattccatatccagtctggtaacctgctgccgcaaaa 18047594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University