View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5975_low_34 (Length: 267)
Name: NF5975_low_34
Description: NF5975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5975_low_34 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 132 - 267
Target Start/End: Complemental strand, 6033266 - 6033131
Alignment:
| Q |
132 |
ctaattaaaactatgtaaattatattggatctgctagaaatatagttgaactttaatttatataatataacatcaaccacactttaaatattggctagaa |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6033266 |
ctaattaaaactatgtaaattatattggatctgctagaaatatagttgaactttaatttatataatataacatcaaccacactttaaatattggctagaa |
6033167 |
T |
 |
| Q |
232 |
ataatacacgcagcatataaatcctttgaagccaaa |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
6033166 |
ataatacacgcagcatataaatcctttgaagccaaa |
6033131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University