View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5975_low_43 (Length: 250)
Name: NF5975_low_43
Description: NF5975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5975_low_43 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 4 - 238
Target Start/End: Complemental strand, 50584943 - 50584700
Alignment:
| Q |
4 |
gggaaaatgattcccctttcttatgttaaatgtcaccatggtaaacggtcaaaacacgtacctatcttcaaaatttaacatctactcgcttaaataaaaa |
103 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| || |
|
|
| T |
50584943 |
gggaaaaggattcccctttcttatgttaaatgtcaccacggtaaacggtcaaaacacgtacgtatcttcaaaatttaacatctacttgcttaaataagaa |
50584844 |
T |
|
| Q |
104 |
agttacatttactcggtaacttcttaaggagaacgaagcacataga---------nnnnnnnnnnatgaaaatggatttcattaacttaagagcaagctg |
194 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
50584843 |
agttacatttactcggtaagttcttaaggagaacgaagcacatagatttttttttttttttttttatgaaaatggatttcattaacttaagagcaagctg |
50584744 |
T |
|
| Q |
195 |
ggaattggaacttcagttcatgatctataggtcatccaaatatt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50584743 |
ggaattggaacttcagttcatgatctataggtcatccaaatatt |
50584700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University