View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5975_low_51 (Length: 236)
Name: NF5975_low_51
Description: NF5975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5975_low_51 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 21 - 218
Target Start/End: Complemental strand, 39429107 - 39428909
Alignment:
| Q |
21 |
gccggcgaccccgattccggcaagagaaactatacttacatggacgctgttcgatctattcttggtaaaactgcttctcctttattatatttgacaaaca |
120 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39429107 |
gccggcgacccccattccggcaagagaaactatacttacatggacgctgttcgctctattcttggtaacactgcttctcctttattatatttgacaaaca |
39429008 |
T |
|
| Q |
121 |
gattatgttccttcgataacaaaaatattactaagtgtcaaaggtcttggagataacatggactgaaatatt-ttttgcaggtggagctaaggttacat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39429007 |
gattatgttccttcgataacaaaaatattactaagtgtcaaaggtcttggagataacatggactgaaatatttttttgcaggtggagctaaggttacat |
39428909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 22 - 88
Target Start/End: Original strand, 6249487 - 6249553
Alignment:
| Q |
22 |
ccggcgaccccgattccggcaagagaaactatacttacatggacgctgttcgatctattcttggtaa |
88 |
Q |
| |
|
|||| ||||| ||||||||||||||||| ||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
6249487 |
ccggtgaccctgattccggcaagagaaaatatacttacatggacgctgttcgctccattcttggtaa |
6249553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 216
Target Start/End: Original strand, 6249672 - 6249716
Alignment:
| Q |
172 |
gataacatggactgaaatattttttgcaggtggagctaaggttac |
216 |
Q |
| |
|
|||||| ||||||||||| | ||||||||||||||| |||||||| |
|
|
| T |
6249672 |
gataacgtggactgaaatgtattttgcaggtggagcaaaggttac |
6249716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University