View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5977-Insertion-13 (Length: 87)
Name: NF5977-Insertion-13
Description: NF5977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5977-Insertion-13 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 77; Significance: 2e-36; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 2e-36
Query Start/End: Original strand, 7 - 87
Target Start/End: Complemental strand, 11629087 - 11629007
Alignment:
| Q |
7 |
catcggtgaccttggaaagtctttttgcaaaatagatcccatgcttcatcttctttcaagggttgcaggttatatacctta |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11629087 |
catcggtgaccttggaaagtctttttgcaaaatagatcccatgcttcatcttctttcaagggttgtaggttatatacctta |
11629007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 3e-26
Query Start/End: Original strand, 12 - 87
Target Start/End: Complemental strand, 11651387 - 11651312
Alignment:
| Q |
12 |
gtgaccttggaaagtctttttgcaaaatagatcccatgcttcatcttctttcaagggttgcaggttatatacctta |
87 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
11651387 |
gtgaccttggaaagtctttctacaaaatagatcccatgcttcatcttctttcaagggttgtaggttatacacctta |
11651312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University