View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5980_high_10 (Length: 362)
Name: NF5980_high_10
Description: NF5980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5980_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 284; Significance: 1e-159; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 17 - 348
Target Start/End: Complemental strand, 41659537 - 41659216
Alignment:
| Q |
17 |
ataatcactgtgctattatgacaatagtaggctatatcatttctacatctatactatactctgtagttttcaccttcagacttgagagatttatggtcat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41659537 |
ataatcactgtgctattatgacaatagtaggctatatcatttctacatctatact-----ctgtagttttcaccttcagacttgagagatttatggccat |
41659443 |
T |
|
| Q |
117 |
gtttattgaattcttttgttcttctcaacttttcccgcttcttgttttcatgattttccaaatatttgattatgcgagattattattgaatcttggttat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41659442 |
gtttattgaattcttttgttcttctcaacttttcccgcttcttgttttcatgattttccaaatatttgattatgcgagattattattgaatcttggttat |
41659343 |
T |
|
| Q |
217 |
ttttacttcatattcaagtaaaataatacatagacttcaagaaatccatgaacactgaactgaaaaggttagtagttttagaaattaggttagtgtacca |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41659342 |
ttttacttcatattcaagtaaaataatacatagacttcaagaaatccatgaacac-----tgaaaaggttagtagttttagaatttaggttagtgtacca |
41659248 |
T |
|
| Q |
317 |
atttggttttactaaactactttgtctttagt |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
41659247 |
atttggttttactaaactactttgtctttagt |
41659216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 279 - 336
Target Start/End: Complemental strand, 41658309 - 41658252
Alignment:
| Q |
279 |
aaaaggttagtagttttagaaattaggttagtgtaccaatttggttttactaaactac |
336 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
41658309 |
aaaaggttagtagattcagaaattaggttagtgtgccaatttggttgtactaaactac |
41658252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University