View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5980_high_8 (Length: 418)
Name: NF5980_high_8
Description: NF5980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5980_high_8 |
 |  |
|
| [»] scaffold0202 (2 HSPs) |
 |  |  |
|
| [»] scaffold0878 (3 HSPs) |
 |  |  |
|
| [»] scaffold0139 (2 HSPs) |
 |  |  |
|
| [»] scaffold0037 (1 HSPs) |
 |  |  |
|
| [»] scaffold0320 (2 HSPs) |
 |  |  |
|
| [»] scaffold0369 (1 HSPs) |
 |  |  |
|
| [»] scaffold0179 (2 HSPs) |
 |  |  |
|
| [»] scaffold1555 (1 HSPs) |
 |  |  |
|
| [»] scaffold0010 (2 HSPs) |
 |  |  |
|
| [»] scaffold0076 (1 HSPs) |
 |  |  |
|
| [»] scaffold0013 (2 HSPs) |
 |  |  |
|
| [»] scaffold0023 (1 HSPs) |
 |  |  |
|
| [»] scaffold0001 (2 HSPs) |
 |  |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 4e-94; HSPs: 18)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 12 - 241
Target Start/End: Original strand, 15154606 - 15154836
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctgaagaatagatttaggcggctatgga-gtctgtag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | | || |||||||| |
|
|
| T |
15154606 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctaaagaatagatttaggcgggttttgaagtctgtag |
15154705 |
T |
 |
| Q |
111 |
cgtggcgatgccttataggataacgcgcccaattttcacaaactttctgaagaacctcttaggtccctacagagggtgtttaagtcctccatgtgggtct |
210 |
Q |
| |
|
|||||||| | |||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
15154706 |
cgtggcgacgtcttataggataacgcgcccaatcttcacagactttctgaagaacctcttaggtccctacagagggtgtttaagtccttcccgtgggtcc |
15154805 |
T |
 |
| Q |
211 |
ctaaactcttaggaatataatgacggtccac |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15154806 |
ctaaactcttaggaatataatgacggtccac |
15154836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 12 - 95
Target Start/End: Original strand, 15142897 - 15142980
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctgaagaatagatttaggcgg |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15142897 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctaaagaatagatttaggcgg |
15142980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 12 - 93
Target Start/End: Original strand, 20435487 - 20435568
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctgaagaatagatttaggc |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
20435487 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgcggtgctttagagctggagaatagatttaggc |
20435568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 19751397 - 19751339
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19751397 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
19751339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 12020481 - 12020539
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12020481 |
gaattttatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
12020539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 19751620 - 19751562
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19751620 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggtgtggtgcttt |
19751562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 24277085 - 24277143
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24277085 |
gaatattatgacggtccacagcccccaagcacaagtcttggcacaaggcgtggtgcttt |
24277143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 12 - 69
Target Start/End: Original strand, 20435698 - 20435755
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctt |
69 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
20435698 |
gaatattatgacggtccacagctcccaagcacaagtcttggtacaaggcgtggtgctt |
20435755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 10 - 70
Target Start/End: Original strand, 24277595 - 24277654
Alignment:
| Q |
10 |
aagaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24277595 |
aagaatattatgacggtccacagcccc-aagcacaagtcttggtacaaggcgtggtgcttt |
24277654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 15154818 - 15154876
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15154818 |
gaatataatgacggtccacagcccctaagcacaagtcttggtacaaggcgtggtgcttt |
15154876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 20514245 - 20514187
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
20514245 |
gaatattatgacggtccacagcccccaagcacaagtcttggcacaagacgtggtgcttt |
20514187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 10 - 71
Target Start/End: Original strand, 24277306 - 24277367
Alignment:
| Q |
10 |
aagaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttta |
71 |
Q |
| |
|
|||||||| || |||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24277306 |
aagaatataataacggtccacagcccccaagcacgagtcttggtacaaggcgtggtgcttta |
24277367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 19911627 - 19911687
Alignment:
| Q |
12 |
gaatattatgacggtccacagccccc--aagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||||||||||||||||||||| | |||| || ||||||||||||||||||||||| |
|
|
| T |
19911627 |
gaatattatgacggtccacagccccccaatgcacgaggcttggtacaaggcgtggtgcttt |
19911687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 12 - 61
Target Start/End: Original strand, 546385 - 546435
Alignment:
| Q |
12 |
gaatattatgacggtccacag-cccccaagcacaagtcttggtacaaggcg |
61 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||||| |||||||| |
|
|
| T |
546385 |
gaatattatgacggtccacagccccccaagcacgaggcttggaacaaggcg |
546435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 12 - 61
Target Start/End: Original strand, 546488 - 546538
Alignment:
| Q |
12 |
gaatattatgacggtccacag-cccccaagcacaagtcttggtacaaggcg |
61 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||||| |||||||| |
|
|
| T |
546488 |
gaatattatgacggtccacagccccccaagcacgaggcttggaacaaggcg |
546538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 12 - 61
Target Start/End: Original strand, 12098901 - 12098951
Alignment:
| Q |
12 |
gaatattatgacggtccacag-cccccaagcacaagtcttggtacaaggcg |
61 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||||| |||||||| |
|
|
| T |
12098901 |
gaatattatgacggtccacagccccccaagcacgaggcttggaacaaggcg |
12098951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 12 - 61
Target Start/End: Original strand, 12099004 - 12099054
Alignment:
| Q |
12 |
gaatattatgacggtccacag-cccccaagcacaagtcttggtacaaggcg |
61 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||||| |||||||| |
|
|
| T |
12099004 |
gaatattatgacggtccacagccccccaagcacgaggcttggaacaaggcg |
12099054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 12 - 61
Target Start/End: Original strand, 19911524 - 19911574
Alignment:
| Q |
12 |
gaatattatgacggtccacag-cccccaagcacaagtcttggtacaaggcg |
61 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||||| |||||||| |
|
|
| T |
19911524 |
gaatattatgacggtccacagccccccaagcacgaggcttggaacaaggcg |
19911574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 171; Significance: 1e-91; HSPs: 18)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 12 - 241
Target Start/End: Original strand, 19011906 - 19012136
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctgaagaatagatttaggcg-gctatggagtctgtag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | | ||| |||||||| |
|
|
| T |
19011906 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctgaagaataaatttaggcgagttttggggtctgtag |
19012005 |
T |
 |
| Q |
111 |
cgtggcgatgccttataggataacgcgcccaattttcacaaactttctgaagaacctcttaggtccctacagagggtgtttaagtcctccatgtgggtct |
210 |
Q |
| |
|
||||||| | |||||||||||||||||||||| |||||| |||||||||| ||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
19012006 |
cgtggcgtcgtcttataggataacgcgcccaatcttcacagactttctgaaaaacctcttaggtccctacatagggtgtttaagtcctccctgtgggtcc |
19012105 |
T |
 |
| Q |
211 |
ctaaactcttaggaatataatgacggtccac |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
19012106 |
ctaaactcttaggaatataatgacggtccac |
19012136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 167; E-Value: 3e-89
Query Start/End: Original strand, 12 - 241
Target Start/End: Original strand, 19019537 - 19019767
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctgaagaatagatttaggcggctatgga-gtctgtag |
110 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| | | || |||||||| |
|
|
| T |
19019537 |
gaatattatgacagtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctaaagaatatatttaggcgggttttgaagtctgtag |
19019636 |
T |
 |
| Q |
111 |
cgtggcgatgccttataggataacgcgcccaattttcacaaactttctgaagaacctcttaggtccctacagagggtgtttaagtcctccatgtgggtct |
210 |
Q |
| |
|
|||||||| | |||||||||||||||||||||| |||||| ||||||| ||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
19019637 |
cgtggcgacgtcttataggataacgcgcccaatcttcacagactttctaaagaacctcttaggtccctacagagggtgtttaagtccttcctgtgggtcc |
19019736 |
T |
 |
| Q |
211 |
ctaaactcttaggaatataatgacggtccac |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
19019737 |
ctaaactcttaggaatataatgacggtccac |
19019767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 12 - 241
Target Start/End: Complemental strand, 8667965 - 8667735
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctgaagaatagatttaggc-ggctatggagtctgtag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| || | || ||||||||| |
|
|
| T |
8667965 |
gaatattatgacggtccacagcccccaagcacaagtattggtacaaggcgtggtgctttagagctaaagaatagatttaggcaggttttgaagtctgtag |
8667866 |
T |
 |
| Q |
111 |
cgtggcgatgccttataggataacgcgcccaattttcacaaactttctgaagaacctcttaggtccctacagagggtgtttaagtcctccatgtgggtct |
210 |
Q |
| |
|
|||||||| | |||||||||||||||||||||| |||||| |||||||||||||||| ||||||||||| ||| |||||||||||||| | |||||||| |
|
|
| T |
8667865 |
cgtggcgacgtcttataggataacgcgcccaatcttcacagactttctgaagaaccttttaggtccctaaagatggtgtttaagtccttcctgtgggtcc |
8667766 |
T |
 |
| Q |
211 |
ctaaactcttaggaatataatgacggtccac |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8667765 |
ctaaactcttaggaatataatgacggtccac |
8667735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 12 - 93
Target Start/End: Complemental strand, 16688431 - 16688350
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctgaagaatagatttaggc |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
16688431 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaagacgtggtgctttagagctgaagaaaagatttaggc |
16688350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 12 - 89
Target Start/End: Original strand, 18929667 - 18929744
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctgaagaatagattt |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
18929667 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttaaagctgatgaatagattt |
18929744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 10 - 93
Target Start/End: Complemental strand, 22467413 - 22467330
Alignment:
| Q |
10 |
aagaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctgaagaatagatttaggc |
93 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22467413 |
aagaatattatgacagtccacaacccccaagcacaagtgttggtacaaggcgtggtgctttaaagctgaagaatagatttaggc |
22467330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 13727927 - 13727985
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13727927 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
13727985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 18929880 - 18929938
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18929880 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
18929938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 20090727 - 20090785
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20090727 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
20090785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 12 - 71
Target Start/End: Complemental strand, 22467199 - 22467140
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttta |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22467199 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgtttta |
22467140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 17997102 - 17997160
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17997102 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggttcttt |
17997160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 19019749 - 19019807
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19019749 |
gaatataatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
19019807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 10 - 71
Target Start/End: Original strand, 17997305 - 17997366
Alignment:
| Q |
10 |
aagaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttta |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
17997305 |
aagaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcatggtgtttta |
17997366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 12 - 71
Target Start/End: Complemental strand, 16688220 - 16688161
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttta |
71 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
16688220 |
gaatattatgacggtccatagcccccaagcacaagtcttggtacaagacgtggtgcttta |
16688161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 19573917 - 19573975
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19573917 |
gaatattatgacggaccatagcccccaagcacaagtcttggcacaaggcgtggtgcttt |
19573975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 12 - 69
Target Start/End: Original strand, 19012118 - 19012177
Alignment:
| Q |
12 |
gaatattatgacggtccaca--gcccccaagcacaagtcttggtacaaggcgtggtgctt |
69 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19012118 |
gaatataatgacggtccacacagcccccaagcacaagtcttggtacaaggcgtggtgctt |
19012177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 66
Target Start/End: Original strand, 20090981 - 20091017
Alignment:
| Q |
30 |
cagcccccaagcacaagtcttggtacaaggcgtggtg |
66 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
20090981 |
cagcccccaagcacaagtcttggttcaaggcgtggtg |
20091017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 12 - 61
Target Start/End: Complemental strand, 11694597 - 11694547
Alignment:
| Q |
12 |
gaatattatgacggtccacagc-ccccaagcacaagtcttggtacaaggcg |
61 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| || ||||| |||||||| |
|
|
| T |
11694597 |
gaatattatgacggtccacagccccccaagcacgaggcttggaacaaggcg |
11694547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 171; Significance: 1e-91; HSPs: 29)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 12 - 241
Target Start/End: Original strand, 26900831 - 26901061
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctgaagaatagatttaggcggctatgga-gtctgtag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | | || |||||||| |
|
|
| T |
26900831 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctaaagaatagatttaggcgggttttgaagtctgtag |
26900930 |
T |
 |
| Q |
111 |
cgtggcgatgccttataggataacgcgcccaattttcacaaactttctgaagaacctcttaggtccctacagagggtgtttaagtcctccatgtgggtct |
210 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |||||||||||||| | |||||||| |
|
|
| T |
26900931 |
cgtggcgacttcttataggataacgcgcccaatcttcacagactttctgaagaacctcttaggtccctacagatggtgtttaagtccttcctgtgggtcc |
26901030 |
T |
 |
| Q |
211 |
ctaaactcttaggaatataatgacggtccac |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
26901031 |
ctaaactcttaggaatataatgacggtccac |
26901061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 12 - 93
Target Start/End: Original strand, 8854317 - 8854398
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctgaagaatagatttaggc |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8854317 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttaaagctgaagaatagatttaggc |
8854398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 122 - 241
Target Start/End: Complemental strand, 18560245 - 18560125
Alignment:
| Q |
122 |
cttataggataacgcgcccaattttcacaaactttctgaagaacctcttaggtccctacagagggt-gtttaagtcctccatgtgggtctctaaactctt |
220 |
Q |
| |
|
|||||| ||||||||||||||| |||||| |||||||||||||||||||||||||||||||| ||| |||||||||| | |||||||| |||| ||||| |
|
|
| T |
18560245 |
cttatatgataacgcgcccaatcttcacagactttctgaagaacctcttaggtccctacagatggtattttaagtccttcctgtgggtccctaagctctt |
18560146 |
T |
 |
| Q |
221 |
aggaatataatgacggtccac |
241 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
18560145 |
aggaatataatgacggtccac |
18560125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 12 - 78
Target Start/End: Original strand, 8854487 - 8854553
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctga |
78 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8854487 |
gaatattatgacggtccacagcccccaaccacaagtcttggtacaaggcgtggtgctttaaagctga |
8854553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 12 - 73
Target Start/End: Original strand, 26901043 - 26901104
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttaga |
73 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26901043 |
gaatataatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttaga |
26901104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 10 - 70
Target Start/End: Original strand, 95017 - 95077
Alignment:
| Q |
10 |
aagaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
95017 |
aagaatataatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
95077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 12 - 71
Target Start/End: Complemental strand, 17601563 - 17601504
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttta |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17601563 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgtttta |
17601504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 94797 - 94855
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
94797 |
gaatattatgacggtccacagcccccaagcacaaatcttggtacaaggcgtggtgcttt |
94855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 14561329 - 14561387
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14561329 |
gaatattgtgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
14561387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 18560143 - 18560085
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18560143 |
gaatataatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
18560085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 10 - 70
Target Start/End: Original strand, 10813259 - 10813319
Alignment:
| Q |
10 |
aagaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10813259 |
aagaatattataacggtccacagcccccaagcacaagtcttggtacaaggcgtggtacttt |
10813319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 10 - 69
Target Start/End: Original strand, 10813476 - 10813535
Alignment:
| Q |
10 |
aagaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctt |
69 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10813476 |
aagaatattataatggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctt |
10813535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 10774205 - 10774263
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10774205 |
gaatataatgacggtccacagccccaaagcacaagtcttggtacaaggcgtggtgcttt |
10774263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 20009318 - 20009376
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20009318 |
gaatataatgacggcccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
20009376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 12 - 69
Target Start/End: Complemental strand, 16091509 - 16091452
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctt |
69 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16091509 |
gaatattatgacggtccatagcccccaagcacaagtcttggcacaaggcgtggtgctt |
16091452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 16091713 - 16091655
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
16091713 |
gaatattatgacggtccatagcccccaagcacaagtcttggcacaagacgtggtgcttt |
16091655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 12 - 83
Target Start/End: Original strand, 20009124 - 20009197
Alignment:
| Q |
12 |
gaatattatgacggtccacagccc-ccaagcacaagtcttggtacaaggcgtggtgc-tttagagctgaagaat |
83 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| || ||||| |||||||||||||| |||| ||||||||||| |
|
|
| T |
20009124 |
gaatattatgacggtccacagccctccaagcacgaggcttggaacaaggcgtggtgcttttaaagctgaagaat |
20009197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 2692439 - 2692380
Alignment:
| Q |
12 |
gaatattatgacggtccacagccccc-aagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| || ||||| ||||||||||||||||| |
|
|
| T |
2692439 |
gaatattatgacggtccacagccccccaagcacgaggcttggaacaaggcgtggtgcttt |
2692380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 12206952 - 12207011
Alignment:
| Q |
12 |
gaatattatgacggtccacagccc-ccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||| ||||||||||||||||| |
|
|
| T |
12206952 |
gaatattatgacggtccacagcccaccaagcatgagtcttggaacaaggcgtggtgcttt |
12207011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 19803507 - 19803566
Alignment:
| Q |
12 |
gaatattatgacggtccacag-cccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||| ||||||||| | || ||||||||||||||||||||||| |
|
|
| T |
19803507 |
gaatattatgacggtccacagccccccaagcgcgaggcttggtacaaggcgtggtgcttt |
19803566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 17 - 70
Target Start/End: Complemental strand, 14433184 - 14433130
Alignment:
| Q |
17 |
ttatgacggtccacagccc-ccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| || |||||||||||||| |
|
|
| T |
14433184 |
ttatgacggtccacagcccaccaagcacaagtcttggaacgaggcgtggtgcttt |
14433130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 20 - 60
Target Start/End: Complemental strand, 28426144 - 28426104
Alignment:
| Q |
20 |
tgacggtccacagcccccaagcacaagtcttggtacaaggc |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28426144 |
tgacggtccacagcccccaagcacaagtcttgggacaaggc |
28426104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 12 - 66
Target Start/End: Original strand, 19803405 - 19803460
Alignment:
| Q |
12 |
gaatattatgacggtccacagccc-ccaagcacaagtcttggtacaaggcgtggtg |
66 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| || ||||| ||||||||||||| |
|
|
| T |
19803405 |
gaatattatgacggtccacagccctccaagcacgaggcttggaacaaggcgtggtg |
19803460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 12 - 61
Target Start/End: Original strand, 15926947 - 15926996
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcg |
61 |
Q |
| |
|
||||||||||| ||| |||||||||||||||| |||||||| |||||||| |
|
|
| T |
15926947 |
gaatattatgaaggttcacagcccccaagcacgagtcttgggacaaggcg |
15926996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 19777658 - 19777717
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccc-caagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||| ||||||||||||||| |||| ||||||| || ||||| ||||||||||||||||| |
|
|
| T |
19777658 |
gaattttatgacggtccacaaccccccaagcacgaggcttggaacaaggcgtggtgcttt |
19777717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 12 - 61
Target Start/End: Complemental strand, 2692542 - 2692492
Alignment:
| Q |
12 |
gaatattatgacggtccacagc-ccccaagcacaagtcttggtacaaggcg |
61 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| || ||||| |||||||| |
|
|
| T |
2692542 |
gaatattatgacggtccacagccccccaagcacgaggcttggaacaaggcg |
2692492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 12 - 61
Target Start/End: Complemental strand, 19789832 - 19789782
Alignment:
| Q |
12 |
gaatattatgacggtccacagc-ccccaagcacaagtcttggtacaaggcg |
61 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| || ||||| |||||||| |
|
|
| T |
19789832 |
gaatattatgacggtccacagccccccaagcacgaggcttggaacaaggcg |
19789782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 12 - 61
Target Start/End: Original strand, 20009021 - 20009071
Alignment:
| Q |
12 |
gaatattatgacggtccacagccc-ccaagcacaagtcttggtacaaggcg |
61 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| || ||||| |||||||| |
|
|
| T |
20009021 |
gaatattatgacggtccacagccctccaagcacgaggcttggaacaaggcg |
20009071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 10774187 - 10774223
Alignment:
| Q |
205 |
gggtctctaaactcttaggaatataatgacggtccac |
241 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
10774187 |
gggtctctaaactttgaggaatataatgacggtccac |
10774223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 167; Significance: 3e-89; HSPs: 35)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 3e-89
Query Start/End: Original strand, 12 - 241
Target Start/End: Complemental strand, 3303043 - 3302813
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctgaagaatagatttaggcggctatgga-gtctgtag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | | || |||||||| |
|
|
| T |
3303043 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctaaagaatagatttaggcgggttttgaagtctgtag |
3302944 |
T |
 |
| Q |
111 |
cgtggcgatgccttataggataacgcgcccaattttcacaaactttctgaagaacctcttaggtccctacagagggtgtttaagtcctccatgtgggtct |
210 |
Q |
| |
|
|||||||| | ||||||||||||||| |||||| |||||| |||||||||||||||||||||||||||||||| | |||||||||||| | |||||||| |
|
|
| T |
3302943 |
cgtggcgacgtcttataggataacgcacccaatcttcacagactttctgaagaacctcttaggtccctacagatgttgtttaagtccttcctgtgggtcc |
3302844 |
T |
 |
| Q |
211 |
ctaaactcttaggaatataatgacggtccac |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3302843 |
ctaaactcttaggaatataatgacggtccac |
3302813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 12 - 93
Target Start/End: Complemental strand, 14676448 - 14676367
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctgaagaatagatttaggc |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14676448 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctggagaatagatttaggc |
14676367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 12 - 89
Target Start/End: Original strand, 36281545 - 36281622
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctgaagaatagattt |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36281545 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctgaagaaaagattt |
36281622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 12 - 93
Target Start/End: Complemental strand, 21408245 - 21408164
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctgaagaatagatttaggc |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
21408245 |
gaatattatgacggtccacagcccccaagcacaagccttggtacaaggcgtggtgctttaaagctgaagaacagatttaggc |
21408164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 12 - 93
Target Start/End: Complemental strand, 21802737 - 21802656
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctgaagaatagatttaggc |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
21802737 |
gaatattatgacggtccacagcccccaagcacaagccttggtacaaggcgtggtgctttaaagctgaagaacagatttaggc |
21802656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 12 - 93
Target Start/End: Complemental strand, 21834698 - 21834617
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctgaagaatagatttaggc |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || |||||||||| |
|
|
| T |
21834698 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttaaagctgaaaaacagatttaggc |
21834617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 36281716 - 36281776
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttag |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36281716 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttag |
36281776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 12 - 69
Target Start/End: Complemental strand, 14676226 - 14676169
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctt |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14676226 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctt |
14676169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 10 - 71
Target Start/End: Complemental strand, 21938284 - 21938223
Alignment:
| Q |
10 |
aagaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttta |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21938284 |
aagaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgtttta |
21938223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 12 - 71
Target Start/End: Complemental strand, 21834486 - 21834427
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttta |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21834486 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgtttta |
21834427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 31711001 - 31710943
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31711001 |
gaatattatgatggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
31710943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 10 - 70
Target Start/End: Complemental strand, 31710781 - 31710721
Alignment:
| Q |
10 |
aagaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31710781 |
aagaatattatgacggtccatagcccccaagcacaagtcttggtacaaggcatggtgcttt |
31710721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 3302831 - 3302773
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3302831 |
gaatataatgacggtccacaacccccaagcacaagtcttggtacaaggcgtggtgcttt |
3302773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 18977166 - 18977108
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18977166 |
gaatataatgacggtccatagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
18977108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 20132067 - 20132125
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
20132067 |
gaatattatgacggtccatagcccccaagcacaagtcttggcacaaggcgtggtgcttt |
20132125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 16 - 70
Target Start/End: Complemental strand, 21938482 - 21938428
Alignment:
| Q |
16 |
attatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21938482 |
attatgacggtccacagcccctaagcacaagtcttggtacaaggcgtggtgcttt |
21938428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 12 - 71
Target Start/End: Complemental strand, 36602408 - 36602348
Alignment:
| Q |
12 |
gaatattatgacggtccacagcc-cccaagcacaagtcttggtacaaggcgtggtgcttta |
71 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36602408 |
gaatattatgacggtccacagccacccaagcacaagtcttgatacaaggcgtggtgcttta |
36602348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 44754060 - 44754001
Alignment:
| Q |
12 |
gaatattatgacggtccacagccccc-aagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44754060 |
gaatattatgacagtccacagccccccaagcacaagtcttggtacaaggcgtggtgcttt |
44754001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 14369597 - 14369539
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
14369597 |
gaatattatgacggtccatagcccccaagcacaagtcttggcacaagacgtggtgcttt |
14369539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 14370148 - 14370090
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
14370148 |
gaatattatgacggtccatagcccccaagcacaagtcttggcacaagacgtggtgcttt |
14370090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 9 - 69
Target Start/End: Original strand, 17526846 - 17526907
Alignment:
| Q |
9 |
caagaatattatgacggtccacag-cccccaagcacaagtcttggtacaaggcgtggtgctt |
69 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
17526846 |
caagaatattatgacggtccacagccccccaagcacaaatcttggaacaaggcgtggtgctt |
17526907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 14 - 70
Target Start/End: Complemental strand, 14369424 - 14369368
Alignment:
| Q |
14 |
atattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
14369424 |
atattatgacggtccatagcccccaagcacaagtcttggcacaagacgtggtgcttt |
14369368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 12 - 68
Target Start/End: Original strand, 22191708 - 22191764
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgct |
68 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22191708 |
gaataatatgaaggtccacagcccccaagcacaagtcttgggacaaggcgtggtgct |
22191764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 6 - 65
Alignment:
| Q |
12 |
gaatattatgacggtccacagccc-ccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||| |||||||||| |||||| |
|
|
| T |
6 |
gaatattatgacggtccacagcccaccaagcacgagtcttggaacaaggcgtgatgcttt |
65 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 12 - 68
Target Start/End: Complemental strand, 15280956 - 15280900
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgct |
68 |
Q |
| |
|
||||||||||| ||| || |||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
15280956 |
gaatattatgatggttcatagcccccaagcacaagtcttgggacaaggcgtagtgct |
15280900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 12 - 68
Target Start/End: Complemental strand, 15461325 - 15461269
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgct |
68 |
Q |
| |
|
||||||||||| ||| || |||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
15461325 |
gaatattatgatggttcatagcccccaagcacaagtcttgggacaaggcgtagtgct |
15461269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 12 - 66
Target Start/End: Original strand, 5009931 - 5009986
Alignment:
| Q |
12 |
gaatattatgacggtccacagccc-ccaagcacaagtcttggtacaaggcgtggtg |
66 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| || ||||| ||||||||||||| |
|
|
| T |
5009931 |
gaatattatgacggtccacagccctccaagcacgaggcttggaacaaggcgtggtg |
5009986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 17 - 70
Target Start/End: Complemental strand, 18977354 - 18977300
Alignment:
| Q |
17 |
ttatgacggtccacagccccc-aagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||| |||||| || ||||| ||||||||||||||||| |
|
|
| T |
18977354 |
ttatgacggtccacagccccccaagcacgaggcttggaacaaggcgtggtgcttt |
18977300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 17 - 70
Target Start/End: Original strand, 26905742 - 26905796
Alignment:
| Q |
17 |
ttatgacggtccacagcccc-caagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||||||||||||||| ||||||| || ||||| ||||||||||||||||| |
|
|
| T |
26905742 |
ttatgacggtccacagccccccaagcacgaggcttggaacaaggcgtggtgcttt |
26905796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 12 - 61
Target Start/End: Original strand, 16078042 - 16078092
Alignment:
| Q |
12 |
gaatattatgacggtccacagccccc-aagcacaagtcttggtacaaggcg |
61 |
Q |
| |
|
||||||||||||||| |||||||||| |||||| |||||||| |||||||| |
|
|
| T |
16078042 |
gaatattatgacggttcacagccccctaagcacgagtcttgggacaaggcg |
16078092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 12 - 61
Target Start/End: Complemental strand, 25547768 - 25547718
Alignment:
| Q |
12 |
gaatattatgacggtccacagccc-ccaagcacaagtcttggtacaaggcg |
61 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| || ||||| |||||||| |
|
|
| T |
25547768 |
gaatattatgacggtccacagccctccaagcacgaggcttggaacaaggcg |
25547718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 17 - 70
Target Start/End: Original strand, 26905547 - 26905601
Alignment:
| Q |
17 |
ttatgacggtccacagcccc-caagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||| |||||||| ||||||| || ||||| ||||||||||||||||| |
|
|
| T |
26905547 |
ttatgacggtcgacagccccccaagcacgaggcttggaacaaggcgtggtgcttt |
26905601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 14 - 62
Target Start/End: Complemental strand, 15280782 - 15280734
Alignment:
| Q |
14 |
atattatgacggtccacagcccccaagcacaagtcttggtacaaggcgt |
62 |
Q |
| |
|
|||| |||||||| || ||||||||||||||||||||| ||||||||| |
|
|
| T |
15280782 |
atataatgacggttcatagcccccaagcacaagtcttgagacaaggcgt |
15280734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 14 - 62
Target Start/End: Complemental strand, 15461151 - 15461103
Alignment:
| Q |
14 |
atattatgacggtccacagcccccaagcacaagtcttggtacaaggcgt |
62 |
Q |
| |
|
|||| |||||||| || ||||||||||||||||||||| ||||||||| |
|
|
| T |
15461151 |
atataatgacggttcatagcccccaagcacaagtcttgagacaaggcgt |
15461103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 205 - 240
Target Start/End: Complemental strand, 18977185 - 18977149
Alignment:
| Q |
205 |
gggtctctaaactctt-aggaatataatgacggtcca |
240 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18977185 |
gggtctctaaactctttaggaatataatgacggtcca |
18977149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 165; Significance: 4e-88; HSPs: 12)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 4e-88
Query Start/End: Original strand, 12 - 241
Target Start/End: Original strand, 7311128 - 7311359
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctgaagaatagatttaggcggctat--ggagtctgta |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | | | || ||||| |
|
|
| T |
7311128 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctaaagaatagatttaggcgggtttttgaagactgta |
7311227 |
T |
 |
| Q |
110 |
gcgtggcgatgccttataggataacgcgcccaattttcacaaactttctgaagaacctcttaggtccctacagagggtgtttaagtcctccatgtgggtc |
209 |
Q |
| |
|
|| |||||| | |||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7311228 |
gcatggcgacgtcttataggataacgcgcccaatcttcacagactttctgaagaacctcttaggtccctacagagggtgtttaagtcctttctgtgggtc |
7311327 |
T |
 |
| Q |
210 |
tctaaactcttaggaatataatgacggtccac |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7311328 |
cctaaactcttaggaatataatgacggtccac |
7311359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 148; E-Value: 6e-78
Query Start/End: Original strand, 12 - 179
Target Start/End: Original strand, 26120866 - 26121033
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctgaagaatagatttaggcggctatggagtctgtagc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26120866 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctgaagaatagatttaggcggctatcgagtctgtagc |
26120965 |
T |
 |
| Q |
112 |
gtggcgatgccttataggataacgcgcccaattttcacaaactttctgaagaacctcttaggtcccta |
179 |
Q |
| |
|
||||||| | ||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26120966 |
gtggcgacgtcttataggataacgcacccaattttcacagactttctgaagaacctcttaggtcccta |
26121033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 148; E-Value: 6e-78
Query Start/End: Original strand, 12 - 179
Target Start/End: Original strand, 26126328 - 26126495
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctgaagaatagatttaggcggctatggagtctgtagc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26126328 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctgaagaatagatttaggcggctatcgagtctgtagc |
26126427 |
T |
 |
| Q |
112 |
gtggcgatgccttataggataacgcgcccaattttcacaaactttctgaagaacctcttaggtcccta |
179 |
Q |
| |
|
||||||| | ||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26126428 |
gtggcgacgtcttataggataacgcacccaattttcacagactttctgaagaacctcttaggtcccta |
26126495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 23696396 - 23696338
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23696396 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
23696338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 4876661 - 4876603
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4876661 |
gaatattatgatggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
4876603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 7311341 - 7311399
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7311341 |
gaatataatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
7311399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 10 - 70
Target Start/End: Complemental strand, 4876441 - 4876381
Alignment:
| Q |
10 |
aagaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4876441 |
aagaatattatgacggtccatagcccccaagcacaagtcttggtacaaggcatggtgcttt |
4876381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 10 - 71
Target Start/End: Complemental strand, 23696194 - 23696133
Alignment:
| Q |
10 |
aagaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttta |
71 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
23696194 |
aagaatgttatgacggtccacagcccccaagcacaagtcttggtgcaaggcgtggtgtttta |
23696133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 9001628 - 9001569
Alignment:
| Q |
12 |
gaatattatgacggtccacagccccc-aagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| || ||||||||||||||||||||||| |
|
|
| T |
9001628 |
gaatattatgacggtccacagccccccaagcacgaggcttggtacaaggcgtggtgcttt |
9001569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 12 - 66
Target Start/End: Complemental strand, 9001730 - 9001675
Alignment:
| Q |
12 |
gaatattatgacggtccacagccccc-aagcacaagtcttggtacaaggcgtggtg |
66 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| || ||||||||||||||||||| |
|
|
| T |
9001730 |
gaatattatgacggtccacagccccccaagcacgaggcttggtacaaggcgtggtg |
9001675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 12 - 66
Target Start/End: Complemental strand, 9001832 - 9001777
Alignment:
| Q |
12 |
gaatattatgacggtccacagccc-ccaagcacaagtcttggtacaaggcgtggtg |
66 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| || ||||| ||||||||||||| |
|
|
| T |
9001832 |
gaatattatgacggtccacagccctccaagcacgaggcttggaacaaggcgtggtg |
9001777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 12 - 61
Target Start/End: Original strand, 7395335 - 7395385
Alignment:
| Q |
12 |
gaatattatgacggtccacag-cccccaagcacaagtcttggtacaaggcg |
61 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||||| |||||||| |
|
|
| T |
7395335 |
gaatattatgacggtccacagccccccaagcacgaggcttggaacaaggcg |
7395385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0202 (Bit Score: 123; Significance: 5e-63; HSPs: 2)
Name: scaffold0202
Description:
Target: scaffold0202; HSP #1
Raw Score: 123; E-Value: 5e-63
Query Start/End: Original strand, 12 - 241
Target Start/End: Original strand, 10627 - 10857
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctgaagaatagatttaggcggctatgga-gtctgtag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| | || |||||||||| ||||||| | | | |||||||| |
|
|
| T |
10627 |
gaatattatgacggtccacagcccccaatcacaagtcttggtacaaggcgtgatgctttaaaactaaagaatagatctaggcgggtttttaagtctgtag |
10726 |
T |
 |
| Q |
111 |
cgtggcgatgccttataggataacgcgcccaattttcacaaactttctgaagaacctcttaggtccctacagagggtgtttaagtcctccatgtgggtct |
210 |
Q |
| |
|
|||||||| | | ||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |||||||||| || | ||||||| |
|
|
| T |
10727 |
cgtggcgacgtcgtataggataacgcgcccaaacttcacagactttctgaagaacctcttaggtccctacagacggtgtttaagcccctccggtgggtcc |
10826 |
T |
 |
| Q |
211 |
ctaaactcttaggaatataatgacggtccac |
241 |
Q |
| |
|
| |||||||||||||||| |||||||||||| |
|
|
| T |
10827 |
caaaactcttaggaatattatgacggtccac |
10857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0202; HSP #2
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 10839 - 10897
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10839 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
10897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 74; Significance: 8e-34; HSPs: 14)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 12 - 89
Target Start/End: Complemental strand, 38840550 - 38840473
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctgaagaatagattt |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38840550 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttagagctgaagaaaagattt |
38840473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 38840379 - 38840319
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttag |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38840379 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgctttag |
38840319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 8460043 - 8459985
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8460043 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
8459985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 26857694 - 26857752
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26857694 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
26857752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 26857917 - 26857975
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26857917 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
26857975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 40936476 - 40936418
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40936476 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
40936418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 32965650 - 32965592
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32965650 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggtgtggtgcttt |
32965592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 10 - 70
Target Start/End: Complemental strand, 40936273 - 40936213
Alignment:
| Q |
10 |
aagaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40936273 |
aagaatattacggcggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
40936213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 40569843 - 40569902
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccc-caagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| || ||||||||||||||||||||||| |
|
|
| T |
40569843 |
gaatattatgacggtccacagccccccaagcacgaggcttggtacaaggcgtggtgcttt |
40569902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 12 - 69
Target Start/End: Original strand, 15213108 - 15213167
Alignment:
| Q |
12 |
gaatattatgacggtccacag--cccccaagcacaagtcttggtacaaggcgtggtgctt |
69 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||| |||||| ||||||||| |
|
|
| T |
15213108 |
gaatattatgacggtccacagcccccccaagcgcaagtcttggaacaaggtgtggtgctt |
15213167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 20 - 61
Target Start/End: Original strand, 43177263 - 43177304
Alignment:
| Q |
20 |
tgacggtccacagcccccaagcacaagtcttggtacaaggcg |
61 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
43177263 |
tgacggtccacagcccccaagcacgagtcttgggacaaggcg |
43177304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 12 - 61
Target Start/End: Original strand, 40572679 - 40572729
Alignment:
| Q |
12 |
gaatattatgacggtccacag-cccccaagcacaagtcttggtacaaggcg |
61 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||||| |||||||| |
|
|
| T |
40572679 |
gaatattatgacggtccacagccccccaagcacgaggcttggaacaaggcg |
40572729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 12 - 61
Target Start/End: Original strand, 40572886 - 40572936
Alignment:
| Q |
12 |
gaatattatgacggtccacag-cccccaagcacaagtcttggtacaaggcg |
61 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||||| |||||||| |
|
|
| T |
40572886 |
gaatattatgacggtccacagccccccaagcacgaggcttggaacaaggcg |
40572936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 12 - 61
Target Start/End: Original strand, 40572989 - 40573039
Alignment:
| Q |
12 |
gaatattatgacggtccacag-cccccaagcacaagtcttggtacaaggcg |
61 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||||| |||||||| |
|
|
| T |
40572989 |
gaatattatgacggtccacagccccccaagcacgaggcttggaacaaggcg |
40573039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 61; Significance: 5e-26; HSPs: 21)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 12 - 83
Target Start/End: Original strand, 23522536 - 23522608
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgc-tttagagctgaagaat |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
23522536 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttttaaagctgaagaat |
23522608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 336 - 399
Target Start/End: Original strand, 24277541 - 24277604
Alignment:
| Q |
336 |
agacaatttttggcaagattttacttacctattgttcaaactttgaattaagagtcttgcttcc |
399 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24277541 |
agacaatttttggcaagattttacttatctattgttcaaactttgaattaagagttttgcttcc |
24277604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 11544607 - 11544549
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11544607 |
gaattttatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
11544549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 10 - 71
Target Start/End: Original strand, 23522757 - 23522818
Alignment:
| Q |
10 |
aagaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttta |
71 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23522757 |
aagaatataataacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttta |
23522818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 5328799 - 5328857
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5328799 |
gaatataatgacggtccacagcccccaagcacaagtcttggtacacggcgtggtgcttt |
5328857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 12 - 66
Target Start/End: Complemental strand, 11100023 - 11099969
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtg |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11100023 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcatggtg |
11099969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 11527203 - 11527145
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11527203 |
gaattttatgacgatccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
11527145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 44360001 - 44359943
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44360001 |
gaatattatgacggtccatagcccccaagcacaagtcttggcacaaggcgtggtgcttt |
44359943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 13 - 70
Target Start/End: Complemental strand, 11544385 - 11544328
Alignment:
| Q |
13 |
aatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11544385 |
aatataataacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
11544328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 15828867 - 15828926
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccc-caagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| || ||||||||||||||||||||||| |
|
|
| T |
15828867 |
gaatattatgacggtccacagccccccaagcacgaggcttggtacaaggcgtggtgcttt |
15828926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 37279093 - 37279152
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccc-caagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| || ||||||||||||||||||||||| |
|
|
| T |
37279093 |
gaatattatgacggtccacagccccccaagcacgaggcttggtacaaggcgtggtgcttt |
37279152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 5328604 - 5328663
Alignment:
| Q |
12 |
gaatattatgacggtccacag-cccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||| ||||||||||||||||| |
|
|
| T |
5328604 |
gaatattatgacggtccacagccccccaagcacgaggattggaacaaggcgtggtgcttt |
5328663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 12 - 66
Target Start/End: Original strand, 15828765 - 15828820
Alignment:
| Q |
12 |
gaatattatgacggtccacagccc-ccaagcacaagtcttggtacaaggcgtggtg |
66 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| || ||||| ||||||||||||| |
|
|
| T |
15828765 |
gaatattatgacggtccacagccctccaagcacgaggcttggaacaaggcgtggtg |
15828820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 12 - 66
Target Start/End: Original strand, 37278991 - 37279046
Alignment:
| Q |
12 |
gaatattatgacggtccacagccc-ccaagcacaagtcttggtacaaggcgtggtg |
66 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| || ||||| ||||||||||||| |
|
|
| T |
37278991 |
gaatattatgacggtccacagccctccaagcacgaggcttggaacaaggcgtggtg |
37279046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 12 - 66
Target Start/End: Original strand, 37283179 - 37283234
Alignment:
| Q |
12 |
gaatattatgacggtccacagccc-ccaagcacaagtcttggtacaaggcgtggtg |
66 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| || ||||| ||||||||||||| |
|
|
| T |
37283179 |
gaatattatgacggtccacagccctccaagcacgaggcttggaacaaggcgtggtg |
37283234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 12 - 66
Target Start/End: Original strand, 362415 - 362469
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtg |
66 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| || |||| ||||||||||||| |
|
|
| T |
362415 |
gaatattatgacggtccacagcccccaaacacgagggttggaacaaggcgtggtg |
362469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 14 - 66
Target Start/End: Original strand, 357768 - 357821
Alignment:
| Q |
14 |
atattatgacggtccacag-cccccaagcacaagtcttggtacaaggcgtggtg |
66 |
Q |
| |
|
||||||||||||||||||| ||||||||||| || ||||| ||||||||||||| |
|
|
| T |
357768 |
atattatgacggtccacagccccccaagcacgaggcttggaacaaggcgtggtg |
357821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 12 - 61
Target Start/End: Original strand, 5328501 - 5328551
Alignment:
| Q |
12 |
gaatattatgacggtccacag-cccccaagcacaagtcttggtacaaggcg |
61 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||||| |||||||| |
|
|
| T |
5328501 |
gaatattatgacggtccacagccccccaagcacgaggcttggaacaaggcg |
5328551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 12 - 61
Target Start/End: Original strand, 5332826 - 5332876
Alignment:
| Q |
12 |
gaatattatgacggtccacag-cccccaagcacaagtcttggtacaaggcg |
61 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||||| |||||||| |
|
|
| T |
5332826 |
gaatattatgacggtccacagccccccaagcacgaggcttggaacaaggcg |
5332876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 5328780 - 5328817
Alignment:
| Q |
205 |
gggtctctaaactctt-aggaatataatgacggtccac |
241 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5328780 |
gggtctctaaactctttaggaatataatgacggtccac |
5328817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 61
Target Start/End: Complemental strand, 9068864 - 9068823
Alignment:
| Q |
20 |
tgacggtccacagcccccaagcacaagtcttggtacaaggcg |
61 |
Q |
| |
|
||||||| |||||||||||||||| |||||||| |||||||| |
|
|
| T |
9068864 |
tgacggttcacagcccccaagcacgagtcttgggacaaggcg |
9068823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0878 (Bit Score: 59; Significance: 7e-25; HSPs: 3)
Name: scaffold0878
Description:
Target: scaffold0878; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 1707 - 1649
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1707 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
1649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0878; HSP #2
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 4119 - 4061
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4119 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
4061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0878; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 12 - 56
Target Start/End: Complemental strand, 1484 - 1439
Alignment:
| Q |
12 |
gaatattatgacggtccacagccc-ccaagcacaagtcttggtaca |
56 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1484 |
gaatattatgacggtccacagccctccaagcacaagtcttggtaca |
1439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0139 (Bit Score: 59; Significance: 7e-25; HSPs: 2)
Name: scaffold0139
Description:
Target: scaffold0139; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 3157 - 3215
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3157 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
3215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0139; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 13 - 70
Target Start/End: Original strand, 3333 - 3390
Alignment:
| Q |
13 |
aatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3333 |
aatataatgacggtccacagcccccaaacacaagtcttggtacaaggcgtggtgcttt |
3390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0037 (Bit Score: 59; Significance: 7e-25; HSPs: 1)
Name: scaffold0037
Description:
Target: scaffold0037; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 20795 - 20853
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20795 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
20853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 59; Significance: 7e-25; HSPs: 14)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 23882008 - 23881950
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23882008 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
23881950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 10 - 70
Target Start/End: Complemental strand, 27788705 - 27788645
Alignment:
| Q |
10 |
aagaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27788705 |
aagaacattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
27788645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 725867 - 725809
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
725867 |
gaatataatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
725809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 10757118 - 10757060
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10757118 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcatggtgcttt |
10757060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 10970289 - 10970231
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10970289 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcatggtgcttt |
10970231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 23882234 - 23882176
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23882234 |
gaatattatgacggtccccagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
23882176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 27788925 - 27788867
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27788925 |
gaatattatgacggttcacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
27788867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 10 - 71
Target Start/End: Complemental strand, 23881806 - 23881745
Alignment:
| Q |
10 |
aagaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttta |
71 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23881806 |
aagaatattaggacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgtttta |
23881745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 12 - 71
Target Start/End: Complemental strand, 20503081 - 20503021
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccc-caagcacaagtcttggtacaaggcgtggtgcttta |
71 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||| ||||||||||||| |||||||||| |
|
|
| T |
20503081 |
gaatattatgattgtccacagcccctcaagcacaagccttggtacaaggcatggtgcttta |
20503021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 10 - 61
Target Start/End: Original strand, 52388654 - 52388706
Alignment:
| Q |
10 |
aagaatattatgacggtccacag-cccccaagcacaagtcttggtacaaggcg |
61 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||| |||||||| |
|
|
| T |
52388654 |
aagaatattatgacggtccacagccccccaagcacgagtcttgggacaaggcg |
52388706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 12 - 69
Target Start/End: Original strand, 28924967 - 28925025
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccc-caagcacaagtcttggtacaaggcgtggtgctt |
69 |
Q |
| |
|
|||||||||||||||| ||| |||| |||||||||||||||| |||||||||| ||||| |
|
|
| T |
28924967 |
gaatattatgacggtctacaaccccccaagcacaagtcttggaacaaggcgtgatgctt |
28925025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 17 - 70
Target Start/End: Complemental strand, 726057 - 726003
Alignment:
| Q |
17 |
ttatgacggtccacagccccc-aagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||| ||||| |||||| || ||||| ||||||||||||||||| |
|
|
| T |
726057 |
ttatgacggtccacaaccccccaagcacgaggcttggaacaaggcgtggtgcttt |
726003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 12 - 61
Target Start/End: Complemental strand, 726165 - 726115
Alignment:
| Q |
12 |
gaatattatgacggtccacagccc-ccaagcacaagtcttggtacaaggcg |
61 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| || ||||| |||||||| |
|
|
| T |
726165 |
gaatattatgacggtccacagccctccaagcacgaggcttggaacaaggcg |
726115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 725886 - 725849
Alignment:
| Q |
205 |
gggtctctaaactctt-aggaatataatgacggtccac |
241 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
725886 |
gggtctctaaactctttaggaatataatgacggtccac |
725849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0320 (Bit Score: 56; Significance: 4e-23; HSPs: 2)
Name: scaffold0320
Description:
Target: scaffold0320; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 12 - 71
Target Start/End: Complemental strand, 11901 - 11842
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttta |
71 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11901 |
gaatattatgacggtccaaagcccccaagcacaagtcttggtacaaggcgtggtgcttta |
11842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0320; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 13 - 71
Target Start/End: Complemental strand, 11688 - 11630
Alignment:
| Q |
13 |
aatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttta |
71 |
Q |
| |
|
||||| ||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11688 |
aatataatgacggtccacaacccccaagcacaggtcttggtacaaggcgtggtgcttta |
11630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0369 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: scaffold0369
Description:
Target: scaffold0369; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 7428 - 7370
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7428 |
gaatattatgacggtccacagcccccaagcacaagtcttagtacaaggcgtggtgcttt |
7370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 51; Significance: 4e-20; HSPs: 2)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 27371 - 27313
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27371 |
gaatattatgacggtccacaacccccaaacacaagtcttggtacaaggcgtggtgcttt |
27313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 10 - 71
Target Start/End: Complemental strand, 27169 - 27108
Alignment:
| Q |
10 |
aagaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttta |
71 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
27169 |
aagaatattatgacggttcacagcccccaagcacaagtcttggtacaaggcttggtgtttta |
27108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1555 (Bit Score: 49; Significance: 7e-19; HSPs: 1)
Name: scaffold1555
Description:
Target: scaffold1555; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 12 - 71
Target Start/End: Complemental strand, 1221 - 1161
Alignment:
| Q |
12 |
gaatattatgacggtccacagcc-cccaagcacaagtcttggtacaaggcgtggtgcttta |
71 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1221 |
gaatattatgacggtccacagccacccaagcacaagtcttgatacaaggcgtggtgcttta |
1161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 244921 - 244862
Alignment:
| Q |
12 |
gaatattatgacggtccacagccccc-aagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| || ||||||||||||||||||||||| |
|
|
| T |
244921 |
gaatattatgacggtccacagccccccaagcacgaggcttggtacaaggcgtggtgcttt |
244862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 12 - 66
Target Start/End: Complemental strand, 245023 - 244968
Alignment:
| Q |
12 |
gaatattatgacggtccacagccc-ccaagcacaagtcttggtacaaggcgtggtg |
66 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| || ||||| ||||||||||||| |
|
|
| T |
245023 |
gaatattatgacggtccacagccctccaagcacgaggcttggaacaaggcgtggtg |
244968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0076 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0076
Description:
Target: scaffold0076; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 15 - 70
Target Start/End: Complemental strand, 49622 - 49566
Alignment:
| Q |
15 |
tattatgacggtccacagccc-ccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||||| ||||||||||||||||| |
|
|
| T |
49622 |
tattatgacggtccacagcccaccaagcacgagtcttggaacaaggcgtggtgcttt |
49566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0013 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 133742 - 133801
Alignment:
| Q |
12 |
gaatattatgacggtccacagccc-ccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||| ||||||||||||||||| |
|
|
| T |
133742 |
gaatattatgacggtccacagcccaccaagcacgggtcttggaacaaggcgtggtgcttt |
133801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0013; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 138271 - 138330
Alignment:
| Q |
12 |
gaatattatgacggtccacagccc-ccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||| ||||||||||||||||| |
|
|
| T |
138271 |
gaatattatgacggtccacagcccaccaagcacgggtcttggaacaaggcgtggtgcttt |
138330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0023 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: scaffold0023
Description:
Target: scaffold0023; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 149752 - 149694
Alignment:
| Q |
12 |
gaatattatgacggtccacagcccccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||| || || ||||||||||| |
|
|
| T |
149752 |
gaatattatgacagtccatagcccccaagcacaagtcttggcactagacgtggtgcttt |
149694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 32; Significance: 0.000000009; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 30203 - 30144
Alignment:
| Q |
12 |
gaatattatgacggtccacagccc-ccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||||||||||| ||||||| ||||| || |||||||| |||| |||||||||||| |
|
|
| T |
30203 |
gaatattatgacggtctacagcccaccaagtacgagtcttggaacaacgcgtggtgcttt |
30144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 35510 - 35451
Alignment:
| Q |
12 |
gaatattatgacggtccacagccc-ccaagcacaagtcttggtacaaggcgtggtgcttt |
70 |
Q |
| |
|
|||||||||||||||| ||||||| ||||| || |||||||| |||| |||||||||||| |
|
|
| T |
35510 |
gaatattatgacggtctacagcccaccaagtacgagtcttggaacaacgcgtggtgcttt |
35451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0088 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 8 - 69
Target Start/End: Complemental strand, 36293 - 36231
Alignment:
| Q |
8 |
ccaagaatattatgacggtccac-agcccccaagcacaagtcttggtacaaggcgtggtgctt |
69 |
Q |
| |
|
||||||||||||||||||||||| | |||||| ||| |||||||| |||||| ||||||||| |
|
|
| T |
36293 |
ccaagaatattatgacggtccacaaccccccattcacgagtcttgggacaaggtgtggtgctt |
36231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University