View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5980_low_14 (Length: 332)
Name: NF5980_low_14
Description: NF5980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5980_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 18 - 149
Target Start/End: Original strand, 39825400 - 39825531
Alignment:
| Q |
18 |
atttgaagtcaaattaagtaaaagagaccgttcttaaaaaaggtaacaggctttatcagatatgtactgaaaaacagaaatcattttcatggctacaaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39825400 |
atttgaagtcaaattaagtaaaagagaccgttcttaaaaaaggtaacaggctttatcagatatgtactgaaaaacagaaatcattttcatggctacaaaa |
39825499 |
T |
 |
| Q |
118 |
gagaaagatacccttttcttctgaggttagga |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
39825500 |
gagaaagatacccttttcttctgaggttagga |
39825531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 206 - 326
Target Start/End: Original strand, 39825584 - 39825702
Alignment:
| Q |
206 |
tacctgtaatctgtaaattgtagtattggattttggtggcatgtgaagtagccggccacaaaattgtttgtatttgagagttgagattttgtcgtgtatt |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39825584 |
tacctgtaatctgtaaattgtagtattggattttggtggcatgtgaagtagccggccacaaaattgtttgtattt--gagttgagattttgtcgtgtatt |
39825681 |
T |
 |
| Q |
306 |
tgattcactctttcatctcac |
326 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
39825682 |
tgattcactctttcatctcac |
39825702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University