View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5980_low_15 (Length: 329)
Name: NF5980_low_15
Description: NF5980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5980_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 18 - 299
Target Start/End: Complemental strand, 28489968 - 28489686
Alignment:
| Q |
18 |
agaccaggtgtcgggtgctgtgacggtggaagtctttcccgactttaaaattaagccggtggttgggagagttgcgtttgtgcttgtagtaagagcagct |
117 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28489968 |
agaccaggtgtcgggggctgtgacggtggaagtctttcccgactttaaaattaagccggtggttgggagagttgcgtttgtgcttgtagtaagagcagct |
28489869 |
T |
 |
| Q |
118 |
ggccacactgcgtagttgcacttgttaattagtgtgaacaccgctgaattggcccctgcaacaggaaacaacatgatttaattctggac-aagtaagatc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28489868 |
ggccacactgcgtagttgcacttgttaattagtgtgaacaccgctgaattggcccctgcaacaggaaacaacatgatttaattctggacaaagtaagatc |
28489769 |
T |
 |
| Q |
217 |
atatgatttataaaaaataaaattaccttaatgtcgnnnnnnnntagagattacctggtaataaaagatgaagggttactaac |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28489768 |
atatgatttataaaaaataaaattaccttaatgtcgaaaaaaaatagagattacctggtaataaaagatgaagggttactaac |
28489686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University