View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5981_high_1 (Length: 454)
Name: NF5981_high_1
Description: NF5981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5981_high_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 344; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 78 - 437
Target Start/End: Complemental strand, 31486328 - 31485969
Alignment:
| Q |
78 |
tcttatggtaacattgataatggattatggaatggtagaggtgtggaaggaggaagagggaagcagaataagggaacaatgatggtgcaaaagaagagtt |
177 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31486328 |
tcttatggtaacattgataatggattgtggaatggtagaggtgtggaaggaggaagagggaagcagaataagggaacaatgatggtgcaaaagaagagtt |
31486229 |
T |
|
| Q |
178 |
tctacgactctactgatttcttccctgaaccaaagcacaatgatttgatctatggagagattgagaaaaggttgaagatgcgtgggattaaccaaccttc |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31486228 |
tctacgactctactgatttcttccctgaaccaaagcacaatgatttgatctatggagagattgagaaaaggttgaagatgcgtgggattaaccaaccttc |
31486129 |
T |
|
| Q |
278 |
tcaagatcttgacacactcaagcatatcttagaggctctgcagcttaaaggtctgcttcattcacaaaaacatgaccaatctcccattgtgctaatgaaa |
377 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31486128 |
tcaagatcttgacacactcaagcatatcttagaggctctgcagcttaaaggtctgcttcattcacaaaaacatgaccaatctcccattgtgctaatgaaa |
31486029 |
T |
|
| Q |
378 |
ccactgagatcttcttctccttctcggttcgagcggtttaatagaaccggttacgattct |
437 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
31486028 |
ccactgagatcttcttctctttctcggtttgagcggtttaatagaaccggttatgattct |
31485969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 234 - 295
Target Start/End: Original strand, 38446710 - 38446771
Alignment:
| Q |
234 |
gagattgagaaaaggttgaagatgcgtgggattaaccaaccttctcaagatcttgacacact |
295 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| | |||||||| |||||||||| ||||| |
|
|
| T |
38446710 |
gagattgagaaacggttgaagatgcgtgggattcatgaaccttctaaagatcttgatacact |
38446771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University