View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5981_high_4 (Length: 368)
Name: NF5981_high_4
Description: NF5981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5981_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 1e-72; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 144 - 286
Target Start/End: Original strand, 44777617 - 44777759
Alignment:
| Q |
144 |
tcatcagctgtgactaaaactaagaaacgtgtaattacaatatagcaaaaaatcaataaatcttacgttaatcaagtcttcgaggtcaatttcgacagat |
243 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44777617 |
tcatcaactgtgactaaaactaagaaacgtgtaattacaatatagcaaaaaatcaataaatcttacgttaatcaagtcttcgaggtcaatttcgacagat |
44777716 |
T |
|
| Q |
244 |
ctggttttgtgatttgcaacatcttgctgaaacgaaaatgaag |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44777717 |
ctggttttgtgatttgcaacatcttgctgaaacgaaaatgaag |
44777759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 44777472 - 44777583
Alignment:
| Q |
1 |
gtctcggtcggctccggcattagttcgtcgattgcatcagcgaaaatcccaatataccttcgagtattctcagtaacacggctcagaaattcctcatcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44777472 |
gtctcggtcggctccggcattagttcgtcgattgcatcagcgaaaatcccaatataccttcgagtattctcagtaacacggctcagaaattcctcatcta |
44777571 |
T |
|
| Q |
101 |
gatctttgtact |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
44777572 |
gatctttgtact |
44777583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 308 - 350
Target Start/End: Original strand, 44777783 - 44777825
Alignment:
| Q |
308 |
ttagggttaaggtttgaatcggaataaaaaagtaactaaccag |
350 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44777783 |
ttagggttaaggtttgaatcggaataaaaaagtaactaaccag |
44777825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University